Ошибка висман f5: Как устранить ошибку f5 газового котла Viessmann Vitopend (Висман Витопенд)

Почему газовый котел Висман выдает код ошибки F5, как сбросить

___________________________________________________________________________


Котел Висман выполняет работу примерно 2-3 минуты, вслед за этим выключается горелка, и появляется ошибка F5. Она мигает не больше минуты, горелочное устройство, вновь начинает работать, и агрегат функционирует безаварийно еще три-четыре минуты, и так много раз. Этот сбой, ссылаясь на инструкцию, указывает на сработку датчика по тяге, однако канал дымохода без засоров, продукты сгорания отводятся нормально. Кто-нибудь может объяснить, в чем неполадка?

В конкретной ситуации, вероятными причинами, влияющими на отсутствие тяги, являются: неисправность пневмореле-датчика тяги. Нет контакта между электронной платой и датчиком тяги. Конденсат в трубках, а также неверное крепление трубок с датчиком-пневмореле. Повредился вентилятор. Возможно, нет положенных оборотов.

___________________________________________________________________________

Похожие вопросы

___________________________________________________________________________

  • Почему котел Ардерия часто начал включаться и выключаться при нагревании
  • В чем неполадка, если газовый котел Аристон показывает ошибку 607, как сбросить ее
  • Как следует устранять на котле Вайлант ошибку с кодом F28
  • Из-за чего котел Висман не функционирует на горячее водоснабжение
  • Как устранить ошибку 43 на котле Риннай
  • Из-за чего стал нагреваться и громко гудеть котел Нева Люкс
  • Из-за чего котел Протерм не работает на ГВС
  • Как следует устранять на газовом котле Иммергаз ошибку 01
  • По какой причине котел Навьен не работает в режиме горячего водоснабжения
  • Как устранить на котле Электролюкс ошибку Е1
  • Как устранить ошибку с кодом F37 на котле Ферроли
  • Как можно устранить на газовом котле Будерус ошибку 6А
  • Из-за чего газовый котел Дэу перестал держать давление
  • Почему газовый котел Бош не функционирует на ГВС
  • В чем неисправность котла Бакси, если он выдает ошибку E01
  • Газовый котел Беретта не держит давление, в чем причина
  • В чем неисправность газового котла Ардерия, если он стал выдавать ошибку А6
  • В газовом котле Аристон снижается давление, в чем причины
  • По каким причинам может греться и гудеть котел Риннай
  • Почему котел Висман при нагревании постоянно начал включаться и выключаться
  • По причине чего котел Ардерия не функционирует в режиме ГВС
  • По каким причинам настенный котел Аристон стал выдавать ошибку с кодом 501
  • В чем неполадка, если котел Бакси выдает ошибку Е03, и как ее исправить
  • Почему котел Будерус выдает ошибку 3С, как ее сбросить
  • Почему часто выключается и включается котел Протерм при нагреве
  • В чем неисправность котла Аристон, если он показывает ошибку 607
  • Как можно устранить на котле Навьен ошибку с кодом 10
  • Какая неполадка с котлом Электролюкс, если он выдает код ошибки Е3
  • Как следует устранять на газовом котле Вайлант ошибку F36
  • Какая неполадка с газовым котлом Протерм, если он выдает ошибку F25
  • Как устранить на газовом котле Висман ошибку с кодом F5
  • В чем неполадка котла Ферроли, если он показывает ошибку с кодом F05
  • Как устранить на котле Бакси ошибку Е03
  • В чем поломка у котла Бош, если он показывает ошибку С6
  • Какая поломка у газового котла Будерус, если он выдает код ошибки 3С
  • В чем неполадка, если котел Риннай выдает ошибку 99, и как ее исправить
  • По какой причине котел Беретта выдает ошибку А03, как ее устранить
  • Почему котел Юнкерс в режиме отопления постоянно выключается и включается
  • Почему постоянно выключается и включается котел Дэу при нагревании
  • Почему котел Bosch постоянно включается и выключается при нагреве
  • Из-за чего котел Термона часто выключается и включается при нагреве
  • Из-за чего котел Селтик при нагреве постоянно включается и выключается
  • В чем неисправность газового котла Вестен, если он выдает ошибку E01
  • Как устранить на газовом котле Кореастар ошибку с кодом А01
  • Как устранить на газовом котле Сеньор Дюваль ошибку с кодом F1
  • Как устранить на газовом котле Celtic ошибку с кодом А6
  • В чем неисправность котла Elsotherm, если он стал выдавать ошибку Е1
  • По каким причинам газовый котел Бугатти стал выдавать ошибку Е01
  • Как можно устранить на котле Мотан ошибку с кодом Е2
  • Почему у котла Иммергаз падает давление
  • По какой причине перестал держать давление газовый котел Китурами
  • В газовом котле Корея Стар падает давление, в чем причины
  • Почему не держит давление котел Мора
  • В котле Навьен снижается давление, в чем неисправность
  • В газовом котле Протерм понижается давление, в чем причины
  • Из-за чего не держит давление котел Риннай
  • По каким причинам котел Аристон выдает код ошибки 101
  • Как устранить на котле Протерм ошибку F20
  • По каким причинам газовый котел Daewoo показывает ошибку с кодом Е3
  • Как следует устранять на котле Навьен ошибку с кодом 16
  • По каким причинам котел Электролюкс выдает ошибку Е2
  • Как устранить на газовом котле Вайлант ошибку F20
  • Какая неполадка с котлом Беретта, если он стал выдавать ошибку А02
  • Как устранить на котле Висман ошибку F2
  • По каким причинам котел Нева Люкс показывает код ошибки 02
  • Как можно устранить на котле Ferroli ошибку А03
  • По каким причинам газовый котел Бакси показывает ошибку Е02
  • Как можно устранить на газовом котле Бош ошибку Е9
  • По каким причинам газовый котел Будерус выдает ошибку 2Е
  • Как следует устранять на котле Оазис ошибку Е3
  • По каким причинам котел Риннай показывает ошибку 16

___________________________________________________________________________

___________________________________________________________________________

___________________________________________________________________________

Код ошибки газового котла Viessmann

Котел Viessmann коды ошибок

Ошибка F2

1) Неисправный конструктивный узел — горелка

2) Контролирующий элемент - ограничитель температуры

Что делать:

- Проверить уровень наполнения отопительной установки (давление).

- Проверить насос, и при необходимости удалить воздух.

- Проверить ограничитель температуры и соединительные кабели.

Ошибка F3 - Неисправна горелка

Необходимо проверить ионизационный электрод, и соединительные кабели.

Ошибка F4 - Неисправна горелка котла Viessmann

Отсутствует сигнал наличия пламени.

- Необходимо проверить электроды розжига, и соединительные кабели.

- Проверить давление газа и газовую регулирующую арматуру, розжиг и модуль розжига.

Ошибка F5 - Неисправность газового топочного автомата котла Viessmann.

Реле давления воздуха при пуске горелки неоткрыто или не закрывается при достижении частоты вращения при нагрузке во время розжига.

- Необходимо проверить систему «Воздух — продукты сгорания» LAS, шланг и реле давления воздуха, реле давления воздуха и соединительные кабели.

Ошибка F6 - Неисправна горелка

Произошло срабатывание устройства опрокидывания тяги 10 раз в течение 24 часов.

- Необходимо проверить систему удаления продуктов сгорания.

Ошибка F8 — неисправна горелка котла Viessmann

Газовая регулирующая арматура закрывается с задержкой.

- Необходимо проверить газовую регулирующую арматуру и оба управляющих кабеля.

Ошибка F9 - Неисправен газовый топочный автомат

Устройство управления модуляционным клапаном неисправно.

- Необходимо проверить устройство управления модуляционным пламенем.

Ошибка F5 на котлах Viessmann Vitopend

Как же выглядят внешние проявления этой неисправности?

Причина 1. Обрастание дымохода льдом

Причина 2. Неправильный монтаж коаксиального дымохода

Помимо обрастания дымохода льдом, ошибка F-5.появляется на дисплее также в том случае, если монтаж коаксиального дымохода был произведен неправильно. Ошибка F-5 может также появиться, если вышел из строя вентилятор котла.

Также она появляется, если собрался конденсат в трубках, подходящих к дифференциальному переключателю

Ошибка A0

Горелка блокирована

Давление газа слишком низкое

Проверить давление газа и реле контроля давления газа

Ошибка E0

Горелка блокирована

Сработало устройство контроля опрокидывания тяги

Проверить газоход.

Указание:

Если устройство контроля опрокидывания тяги в течение 24 ч сработало 10 раз, горелка переходит в режим неисправности (индикация неисправности "F6").

Ошибка F2

Неисправность горелки

Сработал ограничитель температуры

Проверить уровень наполнения отопительной установки. Проверить циркуляционный насос. Удалить воздух из установки. Проверить ограничитель температуры и соединительные кабели. Для деблокирования повернуть ручку регулятора "tr" почти до отказа вправо и затем обратно (сброс).

Ошибка F3

Неисправность горелки

Сигнал пламени имеется уже при пуске горелки

Проверить ионизационный электрод и соединительные кабели.

Выключить и снова включить сетевой выключатель 8 (или выполнить сброс, см. F2).

Ошибка F4

Неисправность горелки

Отсутствует сигнал наличия пламени

Проверить электроды розжига / ионизационный электрод и соединительные кабели, проверить давление газа, проверить газовую регулирующую арматуру, розжиг, трансформатор зажигания.Выключить и снова включить сетевой выключатель 8 (или выполнить сброс, см. F2).

Ошибка F5

Газовый топочный агрегат в состоянии неисправности.

Реле давления воздуха не разомкнуто при пуске горелки или не замыкается при достижении стартовой нагрузки

Проверить систему "Воздух/продукты сгорания", шланги реле давления воздуха, реле давления воздуха и соединительные кабели выключить и снова включить сетевой выключатель 8 (или произвести сброс)

Ошибка F6

Сработало устройство контроля опрокидывания тяги

Проверить датчик опрокидывания тяги.

Выключить и снова включить сетевой выключатель 8 (или выполнить сброс, см. F2).

Ошибка F30

Горелка блокирована

Короткое замыкание датчика температуры котла

Проверить датчик температуры котловой воды

Ошибка F38

Горелка блокирована

Обрыв датчика температуры котла

Проверить датчик температуры котловой воды

Ошибка F50

Нет приготовления горячей воды

Короткое замыкание датчика температуры емкостного водонагревателя (газовый одноконтурный котел)

Проверить датчик

Ошибка F51

Нет приготовления горячей воды

Короткое замыкание датчика температуры горячей воды на выходе, (газовый комбинированный Водогрейный котел)

Проверить датчик

Ошибка F58

Нет приготовления горячей воды

Обрыв датчика температуры емкостного водонагревателя (газовый одноконтурный котел)

Проверить датчик

Ошибка F59

Нет приготовления горячей воды

Обрыв датчика температуры горячей воды на выходе (газовый комбинированный водогрейный котел)

Проверить датчик

Ошибка b0

Горелка блокирована

Короткое замыкание датчика контроля опрокидывания тяги

Проверить датчик

Ошибка b8

Горелка блокирована

Обрыв датчика контроля опрокидывания тяги

Проверить датчик

Яндекс Дзен | Открывайте новое каждый день

Яндекс Дзен | Открывайте новое каждый день

Яндекс. Дзен – это платформа, которая подбирает контент специально для вас. В Дзене есть статьи и видео на разные темы от блогеров и медиа.

Ваш личный Дзен

Дзен понимает ваши интересы и собирает ленту для вас. Он анализирует действия: что вы смотрите, кому ставите лайки, на кого подписываетесь, а после – рекомендует вам и уже любимые источники, и ещё неизвестные, но интересные публикации.

Вы смотрите и ставите лайки

шаг 1

Алгоритм отслеживает это и подбирает контент

шаг 2

Вы видите интересные именно вам материалы

шаг 3

Интересные истории

В Дзене есть популярные медиа и талантливые блогеры. Ежедневно они создают тысячи историй на сотни разных тем. И каждый находит в Дзене что-нибудь для себя.

Примеры публикаций

В Дзене действительно много уникальных статей и видео. Вот несколько примеров популярного сейчас контента.

Дзен — простой, современный и удобный

Посмотрите на главные возможности сервиса и начните пользоваться всеми преимуществами Дзена.

Читайте о своих интересах.

Алгоритмы Дзена понимают, что вам нравится, и стараются показывать только то, что будет действительно интересно. Если источник вам не подходит - его можно исключить.

1/4

Тематические ленты.

С общей ленты со всеми статьями легко переключайтесь на тематические: кино, еда, политика, знаменитости.

2/4

Разнообразные форматы.

Открывайте разные форматы историй для чтения и общения. В приложении удобно читать статьи и смотреть видео, писать комментарии.

3/4

Оставайтесь в курсе событий!

Возвращайтесь к нужным статьям: добавляйте статьи в Сохранённое, чтобы прочитать их позже или сохранить в коллекции. Настройте уведомления, чтобы не пропустить самое интересное от любимых блогеров, медиа и каналов.

4/4

Читайте о своих интересах.

Алгоритмы Дзена понимают, что вам нравится, и стараются показывать только то, что будет действительно интересно. Если источник вам не подходит - его можно исключить.

1/4

Тематические ленты.

С общей ленты со всеми статьями легко переключайтесь на тематические: кино, еда, политика, знаменитости.

2/4

Разнообразные форматы.

Открывайте разные форматы историй для чтения и общения. В приложении удобно читать статьи и смотреть видео, писать комментарии.

3/4

Оставайтесь в курсе событий!

Возвращайтесь к нужным статьям: добавляйте статьи в Сохранённое, чтобы прочитать их позже или сохранить в коллекции. Настройте уведомления, чтобы не пропустить самое интересное от любимых блогеров, медиа и каналов.

4/4

Читайте о своих интересах.

Алгоритмы Дзена понимают, что вам нравится, и стараются показывать только то, что будет действительно интересно. Если источник вам не подходит - его можно исключить.

1/4

Тематические ленты.

С общей ленты со всеми статьями легко переключайтесь на тематические: кино, еда, политика, знаменитости.

2/4

Разнообразные форматы.

Открывайте разные форматы историй для чтения и общения. В приложении удобно читать статьи и смотреть видео, писать комментарии.

3/4

Оставайтесь в курсе событий!

Возвращайтесь к нужным статьям: добавляйте статьи в Сохранённое, чтобы прочитать их позже или сохранить в коллекции. Настройте уведомления, чтобы не пропустить самое интересное от любимых блогеров, медиа и каналов.

4/4

Дзен доступен во всем мире более чем на 50 языках

Смело рекомендуйте Дзен своим друзьям из других стран.

العَرَبِيَّة‎العَرَبِيَّة‎
Удобно пользоваться в смартфоне

У Дзена есть приложения для iOS и Android.

Пользуйтесь в браузере

Дзен доступен с любого устройства в вашем любимом браузере. Также Дзен встроен в Яндекс.Браузер.

Удобно пользоваться в смартфоне

У Дзена есть приложения для iOS и Android.

Пользуйтесь в браузере

Дзен доступен с любого устройства в вашем любимом браузере. Также Дзен встроен в Яндекс.Браузер.

Удобно пользоваться в смартфоне

У Дзена есть приложения для iOS и Android.

Пользуйтесь в браузере

Дзен доступен с любого устройства в вашем любимом браузере. Также Дзен встроен в Яндекс.Браузер.

© 2015–2021 ООО «Яндекс», 0+

Дизайн и разработка — Charmer

К сожалению, браузер, которым вы пользуйтесь, устарел и не позволяет корректно отображать сайт. Пожалуйста, установите любой из современных браузеров, например:

Яндекс.Браузер Google Chrome Firefox Safari

Вероятные ошибки, их коды и неисправности котлов Висман (Viessmann)

Вероятные ошибки и причины возникновения

В этой статье собраны все вероятные неисправности и варианты их устранения, а так же коды ошибок для котлов Висман (Viessmann). Вся информация читается в следующем порядке: код — наименование — возможная неисправность. Если у вас возникли какие-либо дополнительные вопросы, просьба оставлять их в комментариях к данной статье.

Если вы на 100% не уверены в чем именно проблема и в том, что вы сможете ее решить — немедленно обратитесь в сервисный центр для диагностики и устранения неисправности.

Основные коды ошибок котлов Viessmann

В этом списке собраны те неисправности котлов Висман, которые встречаются чаще всего. Находите код ошибки и исправляйте неполадки своевременно.

Код ошибки 06 — Горелка заблокирована. Давление в установке слишком низкое

Проверить давление в установке. Если потребуется, долить теплоноситель.

Код ошибки 0A — Горелка заблокирована. Динамическое давление газа слишком низкое

Проверить давление газа и реле контроля давления газа.

Код ошибки 0C — Горелка заблокирована. Напряжение сети слишком низкое

Проверить напряжение сети.

Код ошибки CC — Неисправность функции внешнего модуля расширения

Связь между контроллером и внешним модулем расширения прервана. Проверить соединительный кабель между контроллером и внешним модулем расширения.

Код ошибки F2 — Горелка неисправна. Срабатывает ограничитель температуры

Горелка в состоянии неисправности. Сработал ограничитель температуры. Проверить уровень наполнения отопительной установки. Проверить насос. Удалить воздух из установки. Проверить ограничитель температуры и соединительные кабели. Одновременно нажимать кнопки MODE и OK, пока не начнет мигать (сброс).

Код ошибки F3 — Горелка неисправна. Сигнал пламени до пуска горелки

Горелка в состоянии неисправности. Сигнал пламени имеется до пуска горелки. Проверить ионизационный электрод и соединительный кабель. Выключить и снова включить сетевой выключатель или выполнить сброс.

Код ошибки F4 — Горелка неисправна. Нет сигнала пламени

Горелка в состоянии неисправности. Отсутствует сигнал пламени. Проверить электроды розжига/ионизационный электрод и соединительные кабели, проверить давление газа, проверить газовую регулирующую арматуру, розжиг и модуль розжига. Выключить и снова включить сетевой выключатель или выполнить сброс.

Код ошибки F5 — Ошибка топочного автомата

Топочный автомат в состоянии неисправности. Реле давления воздуха не разомкнуто при пуске горелки или не замыкается при достижении нагрузки розжига. Проверить систему «Воздух/продукты сгорания», шланги реле давления воздуха, реле давления воздуха и соединительные кабели. Выключить и снова включить сетевой выключатель (выполнить сброс).

Код ошибки F6 — Срабатывание устройства контроля опрокидывания тяги

Сработало устройство контроля опрокидывания тяги. Проверить датчик опрокидывания тяги.

Код ошибки F8 — Горелка неисправна. Реле газового электромагнитного клапана блокировано

Горелка в состоянии неисправности. Реле газового электромагнитного клапана блокировано. Проверить реле, газовый электромагнитный клапан и соединительные кабели. Выключить и снова включить сетевой выключатель или выполнить сброс.

Код ошибки F10/F18 — Постоянный режим работы

Короткое замыкание датчика наружной температуры или датчика температуры помещения.

Код ошибки F30 — Горелка заблокирована. Короткое замыкание датчика температуры

Проверить датчик температуры котла.

Код ошибки F38 — Горелка заблокирована. Обрыв датчика температуры котла

Проверить датчик температуры.

Код ошибки F50/F51 — Ошибка работы системы ГВС, короткое замыкание

Не работает система ГВС. Короткое замыкание датчика температуры емкостного водонагревателя (одноконтурная модель).

Код ошибки F58/F59 — Ошибка работы системы ГВС, обрыв датчика температуры

Не работает система ГВС. Обрыв датчика температуры емкостного водонагревателя (одноконтурный котел).

Другие ошибки котлов Висман

Код ошибки А0 — Горелка блокирована. Давление газа слишком низкое

Проверить давление газа и реле контроля давления газа.

Код ошибки E0 — Горелка блокирована. Сработало устройство контроля опрокидывания тяги

Проверить газоход. Если устройство контроля опрокидывания тяги в течение 24 ч сработало 10 раз, горелка переходит в режим неисправности (индикация ошибки Ф5).

Код ошибки b0 — Горелка заблокирована, короткое замыкание

Короткое замыкание датчика контроля опрокидывания тяги.

Код ошибки b8 — Горелка заблокирована, обрыв датчика

Обрыв датчика контроля опрокидывания тяги.

Код ошибки 0F — Обслуживание «0F» отображается только в истории ошибок

Обслуживание «0F» отображается только в истории ошибок.

Код ошибки 10 — Короткое замыкание датчика наружной температуры

Короткое замыкание датчика наружной температуры.

Код ошибки 18 — Обрыв датчика наружной температуры

Обрыв датчика наружной температуры.

Код ошибки 30 — Короткое замыкание температурного датчика

Короткое замыкание датчика температуры.

Код ошибки 38 — Обрыв температурного датчика

Обрыв датчика температуры.

Код ошибки 40 — Короткое замыкание температурного датчика (контур 2, со смесителем)

Короткое замыкание датчика температуры подачи, отопительный контур 2 (со смесителем).

Код ошибки 44 — Короткое замыкание температурного датчика подачи (контур 3, со смесителем)

Короткое замыкание датчика температуры подачи, отопительный контур 3 (со смесителем).

Код ошибки 48 — Обрыв температурного датчика подачи (конур 2, со смесителем)

Обрыв датчика температуры подачи, отопительный контур 2 (со смесителем).

Код ошибки 4С — Обрыв температурного датчика подачи (конур 3, со смесителем)

Обрыв датчика температуры подачи, отопительный контур 3 (со смесителем).

Код ошибки 50 — Короткое замыкание температурного датчика бойлера

Короткое замыкание датчика температуры емкостного водонагревателя.

Код ошибки 52 — Короткое замыкание температурного датчика буферной емкости

Короткое замыкание датчика температуры буферной емкости.

Код ошибки 58 — Обрыв температурного датчика бойлера

Обрыв датчика температуры емкостного водонагревателя.

Код ошибки 5А — Обрыв температурного датчика буферной емкости

Обрыв датчика температуры буферной емкости.

Код ошибки 90 — Короткое замыкание температурного датчика

Короткое замыкание датчика температуры, подключение к модулю управления гелиоустановкой.

Опросы статуса

IF-01 — Фактическая температура теплоносителя.

IF-02 — Заданная температура теплоносителя.

IF-03 — Настройка максимальной тепловой мощности.

IF-04 — Фактическая температура воды в контуре ГВС.

IF-05 — Заданная температура воды в контуре ГВС.

IF-06 — Расход воды в контуре ГВС.

IF-07 — Фактическая температура в коллекторе (только в сочетании с модулем внешнего расширения).

IF-08 — Фактическая температура в нижней части емкостного водонагревателя (только в сочетании с модулем внешнего расширения).

IF-09 — Фактическая температура в верхней части емкостного водонагревателя (только в сочетании с модулем внешнего расширения).

IF-10 — Фактическая наружная температура (при работе с датчиком наружной температуры).

IF-10 — Фактическая температура помещения (при работе с датчиком температуры помещения).

IF-11 — Настройка кривой отопления (при работе с датчиком наружной температуры).

IF-11 — Настройка заданной температуры помещения (при работе с датчиком температуры помещения).

IF-12 — Состояние горелки.

IF-13 — Текущее значение тока модуляции.

IF-14 — Текущее значение мощности горелки.

IF-16 — Положение газового электромагнитного клапана (On или OFF).

IF-17 — Состояние вентилятора (On или OFF).

IF-18 — Состояние насоса (On или OFF).

IF-19 — Положение 3-ходового переключающего клапана (для отопления).

IF-21 — Тип котла.

Ошибка F4 для котлов Viessmann Vitopend и другие коды ошибок

Код F4 свидетельствует об отсутствии пламени горелки в котле Viessmann Vitopend 100-W. Как известно именно надёжность котлов Виссманн позволила завоевать лидирующее положение на европейском рынке, в свете чего у владельца котла возникают вопросы. Так в чём же может быть причина возникшей проблемы?

Каковы ваши действия?

Причины возникновения ошибки F4

Часто причиной этой ошибки могут стать внешние факторы, не зависящие от самого котла.

Проблемы с подачей газа
В данном случае причина нестабильное или недостаточное давление газа, что не позволяет котлу корректно работать. Самый простой способ проверить – посмотреть на качество пламени на газовой плите при розжиге всех конфорок одновременно. Если пламя нестабильно, то стоит обратиться к газовщикам.

Проблема с электросетью

  • Проблемы с заземлением, электропроводкой и напряжением могут привести к неисправности автоматики. Для проверки требуется провести следующие действия:
  • Проверить исправность стабилизатора напряжения – скачки напряжения весьма распространённая проблема для Украины, именно она может вызывать сбои автоматики и даже выход из строя техники. Именно по этому всегда требуется устанавливать стабилизаторы напряжения для корректной работы котла.
  • Проверить качество контактов заземления, если они окислились – может сработать защита.
  • Если все вышеперечисленные пункты выполнены – выполнить сброс котла кнопкой на лицевой панели.

Проблема с модулем розжига котла

Самостоятельно пытаться устранять неисправность не стоит. Стоит обратиться к сертифицированным сервисным специалистам. Повредив по неосторожности или незнанию оборудование только увеличит стоимость ремонта. А если котёл на гарантии, то ещё и лишит возможности бесплатного сервиса.

Таким образом эта ошибка e Viessmann Vitopend 100 F4 часто возникает не из-за технических неисправностей котла. В целом нужно понимать, что f4 Viessmann можно предотвратить проводя ежегодное техническое обслуживание и следя за исправностью прочих компонентов системы отопления.

Коды ошибок

Помимо F4 существуют ещё ряд кодов, сигнализирующих о проблемах. Мы приведём только часть из них. Полный список с описаниями в инструкциях по сервисному обслуживанию для специалистов. В большинстве случаев владельцу котла не нужно знать их, это задача сервисантов.

03

Ошибка в работе контроллера, требуется привлечение сервисного инженера.

Пониженное напряжение в сети. Как уже было сказано ранее – нужно установить стабилизатор. Он должен быть способен корректно работать в диапазоне колебаний напряжения.

B7

Неисправный кодирующий штекер котла, требуется привлечение сервисного инженера.

F2

Отключение горелки из-за превышения допустимой температуры. Основные причины может быть три.
Первая. Снижения уровня теплоносителя в системе по какой-либо причине.
Вторая. Проблемы с работой циркуляционного насоса.
Третья. Ошибка ограничителя температуры из-за его неисправности или окислившихся контактов.

F5

Неисправность газового топочного автомата, при пуске горелки реле давления воздуха закрыто. Причина может крыться в .самом реле или герметичности шланга.

FC

Блокировка горелки из-за контроллера управления вентилятора. Может быть вызвано неисправностью контроллера, вентилятора или их электропроводки.

Надеемся вам была полезна данная информация. Если у вас возникли проблемы с котлом Виссманн – обращайтесь по контактным телефонам указанным в гарантийном талоне для вызова сертифицированного сервисного инженера. Не пытайтесь решить проблемы с газовым оборудованием самостоятельно.

Газовый Котел Viessmann Vitopend 100 Инструкция Ошибка F5

У нас в частном доме установлен 2-х контурный котел vitopend. Котел выдает ошибку F5. Причина выхода аварии F5, на котле viessmann vitopend 100. Viessmann vitopend 100 ошибка F5. Газовый котёл. Инструкцию Телефона Panasonic Kx-Tca120Ru.

Ошибка F-5 на котлах Viessmann Vitopend Если Вы сталкивались когда-либо с неисправностями, возникающими на котлах Viessmann Vitopend с закрытой камерой сгорания, Вы наверняка слышали о самой распространенной ошибке, появляющейся на дисплее этого типа котлов – Ошибке F-5. Как же выглядят внешние проявления этой неисправности? Обрастание дымохода льдом Ошибка F- 5 – типичная ошибка, которая сигнализирует в большинстве случаев о том, что есть проблемы с выхлопом, выходом дымовых газов в атмосферу. Viessmann, указано, что минимальная длина коаксиала котла до выхода наружу должна быть не менее одного метра и иметь как минимум один поворот на 87 градусов. Если эти требования не выполняются – появляется ошибка F-5.

Практика установки коаксиальных дымоходов показывает, что для холодных российских регионов приемлемая длина коаксиала по теплому помещению должна быть 1,5 – 2 метра. Невыполнение этих условий влечет за собой размораживание пластинчатого теплообменника котла, из-за чего выходит из строя дифференциальный переключатель.

На данном фото показан пример правильно смонтированного дымохода, при условии, что дымовые газы уходят вверх по дымовому каналу. Иные причины Ошибка F-5 может также появиться, если вышел из строя вентилятор котла. Также она появляется, если собрался конденсат в трубках, подходящих к дифференциальному переключателю. Как обезопасить себя от ошибки F-5 Чтобы сделать ошибку F-5 неопасной для Вашего котла, советуем приобрести комплект дымохода против обледенения. Такой комплект Вам понадобится, если Вы отводите дымовые газы в стену.

Этот комплект позволяет правильно распределить потоки отходящих газов от котла и приток свежего воздуха для горения.

Коды ошибок и неисправности газовых котлов висман

Автор Евгения На чтение 30 мин. Опубликовано

Системы отопления дачных и загородных домов. Котлы, газовые колонки, водонагреватели – Ремонт, сервис, эксплуатация. Рекомендации по монтажу и установке.

НЕИСПРАВНОСТИ И РЕМОНТ

РЕМОНТ ГАЗОВОЙ КОЛОНКИ

ЗАПАСНЫЕ ЧАСТИ КОТЛОВ

Ремонт и коды ошибок котлов Viessmann Vitopend 100-W

Замена проточного теплообменника

Закрыть настенный котел Viessmann Vitopend 100-W со стороны отопительного контура и со стороны контура водоразбора ГВС и слить из него воду.

Рис.8. Демонтаж проточного теплообменника

E – Подающая магистраль греющего контура, F – Обратная магистраль греющего контура, G – Трубопровод холодной воды, H – Трубопровод горячей воды

Проверить подключения контура водоразбора ГВС на наличие накипи, а подключения греющего контура на загрязнение. При необходимости очистить или заменить проточный теплообменник.

Работы по замене проточного теплообменника:

– Немного сместить шаговый двигатель A вверх.

– Повернуть адаптер шагового двигателя B с шаговым двигателем A на 1/8 оборота против часовой стрелки и вынуть его.

– Ослабить два винта C на проточном теплообменнике и вынуть проточный теплообменник D вместе с уплотнениями.

– Сборка проточного теплообменника D осуществляется в обратном порядке с использованием новых уплотнений. Крутящий момент крепежных винтов: 5,5 Нм.

– При монтаже следить за положением крепежных отверстий и правильной посадкой уплотнений.

– Обеспечить правильное положение при монтаже проточного теплообменника. Соблюдать маркировку “Top” (верх).

– Выполнить сборку водогрейного котла в обратном порядке.

– Наполнить водогрейный котел водой, прокачать (удалить воздух) и проверить герметичность.

Ограничитель температуры и датчики котла Висман Витопенд 100-W

Рис.9. Снятие ограничителя температуры и датчиков котлов Viessmann Vitopend 100-W

A – Ограничитель температуры, B – Датчик температуры котловой воды, C – Датчик температуры горячей воды на выходе (газовый комбинированный котел), D – Датчик контроля опрокидывания тяги, 5 – Датчик температуры емкостного водонагревателя (газовый одноконтурный котел)

Выполнить проверку на предмет того, что после аварийного отключения газовый топочный автомат не деблокируется, хотя температура котловой воды составляет ниже 90 °C.

– Отсоединить кабели от датчика.

– Проверить пропускание тока ограничителем температуры с помощью универсального измерительного прибора.

– Демонтировать неисправный ограничитель температуры.

– Установить новый ограничитель температуры.

– Для деблокирования повернуть ручку регулятора на короткое время до отказа вправо и затем обратно. Процесс розжига повторяется.

Датчик температуры котловой воды:

– Отсоединить кабели от датчика.

– Измерить сопротивление датчика и сравнить его с характеристикой.

– При сильном отклонении заменить датчик.

– Датчик температуры котловой воды находится непосредственно в теплоносителе (опасность ошпаривания).

– Перед заменой датчика слить воду из водогрейного котла.

Датчик температуры на выходе (газовый комбинированный водогрейный котел Viessmann Vitopend):

– Отсоединить кабели от датчика.

– Измерить сопротивление датчика и сравнить его с характеристикой.

– При сильном отклонении заменить датчик.

– Перед заменой датчика опорожнить водогрейный котел на стороне контура водоразбора ГВС.

Датчик контроля опрокидывания тяги:

– Отсоединить кабели от датчика.

– Измерить сопротивление датчика и сравнить его с характеристикой.

– При сильном отклонении заменить датчик.

Датчик температуры емкостного водонагревателя (газовый одноконтурный котел Висман Витопенд):

– Отсоединить штекер 5 от кабельного жгута снаружи контроллера.

– Измерить сопротивление датчика и сравнить его с характеристикой.

– При сильном отклонении заменить датчик.

Индикация неисправности (коды ошибок) котлов Viessmann Vitopend 100-W и их устранение

A0 – Горелка блокирована

Давление газа слишком низкое – Проверить давление газа и реле контроля давления газа

E0 – Горелка блокирована

Сработало устройство контроля опрокидывания тяги – Проверить газоход. Если устройство контроля опрокидывания тяги в течение 24 ч сработало 10 раз, горелка переходит в режим неисправности (индикация неисправности “F6”).

F2 – Неисправность горелки

Сработал ограничитель температуры – Проверить уровень наполнения отопительной установки. Проверить циркуляционный насос. Удалить воздух из установки.

Проверить ограничитель температуры соединительные кабели. Для деблокирования повернуть ручку регулятора почти до отказа вправо и затем обратно (сброс).

F3 – Неисправность горелки

Сигнал пламени имеется уже при пуске горелки – Проверить ионизационный электрод и соединительные кабели. Выключить и снова включить сетевой выключатель 8 (или выполнить сброс, см. F2).

F4 – Неисправность горелки

Отсутствует сигнал наличия пламени – Проверить электроды розжига / ионизационный электрод и соединительные кабели, проверить давление газа, проверить газовую регулирующую арматуру, розжиг, трансформатор зажигания.

F6 – Неисправность горелки

Сработало устройство контроля опрокидывания тяги – Проверить датчик опрокидывания тяги.

F30 – Горелка блокирована

Короткое замыкание датчика температуры котла – Проверить датчик температуры котловой воды.

F38 – Горелка блокирована

Обрыв датчика температуры котла – Проверить датчик температуры котловой воды.

F50 – Нет приготовления горячей воды

Короткое замыкание датчика температуры емкостного водонагревателя (газовый одноконтурный котел Висман Витопенд) – Проверить датчик.

F51 – Нет приготовления горячей воды

Короткое замыкание датчика температуры горячей воды на выходе (газовый комбинированный водогрейный котел Viessmann Vitopend) – Проверить датчик температуры.

F58 – Нет приготовления горячей воды

Обрыв датчика температуры емкостного водонагревателя (газовый одноконтурный котел Viessmann Vitopend 100) – Проверить датчик.

F59 – Нет приготовления горячей воды

Обрыв датчика температуры горячей воды на выходе (газовый комбинированный водогрейный котел Висман Витопенд) – Проверить датчик.

b0 – Горелка блокирована

Короткое замыкание датчика контроля опрокидывания тяги – Проверить датчик контроля опрокидывания тяги.

b8 – Горелка блокирована

Обрыв датчика контроля опрокидывания тяги – Проверить датчик.

Возможные причины изменения температуры в помещении

В помещениях слишком холодно:

– Неправильная настройка регулятора температуры помещений – Установить на регуляторе температуры помещений нужную температуру помещения.

– Отопительная установка отключена – Включить сетевой выключатель. Включить главный выключатель при его наличии (находится за пределами котельной). Проверить предохранитель в распределительном электрическом щите (предохранитель домового ввода).

– Неправильная настройка контроллера – Установить ручкой регулятора более высокую температуру теплоносителя.

– Приоритет приготовления горячей воды – Закончить отбор горячей воды или дождаться окончания нагрева емкостного водонагревателя.

– Индикация неисправности на дисплее: Появляется символ “U” и код неисправности, например, “F2” – Повернуть ручку регулятора почти до отказа вправо и затем обратно (сброс). Если снова появится индикация неисправности, обратиться на фирму по отопительной технике.

– Воздух в отопительной установке – Удалить воздух из радиаторов.

– Отсутствует топливо – Открыть запорный газовый кран.

– Неисправность в системе приточного воздуха или в газовом тракте – Обратиться в сервисную службу по отопительной технике.

– Циркуляционный насос неисправен – Обратиться в сервисную службу.

В помещениях слишком тепло:

– Неправильная настройка регулятора температуры помещений – Установить на регуляторе температуры помещений нужную температуру помещения

– Неправильная настройка контроллера – Установить ручкой регулятора более низкую температуру горячей воды.

Неисправности газовых котлов Viessmann – коды, причины и способы устранения

Немецкие газовые котлы висман считаются одними из лучших. Но иногда в процессе их работы появляются неполадки. Современные модели управляются со смартфона, что дает возможность изменить настройки или отрегулировать работу агрегата даже за пределами дома. Система самодиагностики выявляет неисправности газового котла висман и выводит их коды на дисплей.

Коды ошибок газового агрегата Viessmann vitopend 100

Чтобы разобраться, что означает код неисправности газового котла висман vitopend 100, следует посмотреть инструкцию. Но не все коды говорят о поломке агрегата, некоторые указывают на работу определенного режима.

Рассмотрим коды неисправностей газового котла висман витопенд, причины их появления и методы устранения поломок.

Ошибка F2 указывает на:

  • поломки в горелочном устройстве;
  • срабатывание ограничителя температуры.

Исправить положение можно следующими методами:

  • проверить давление в системе;
  • удалить лишний воздух из отопительной системы;
  • проверить работоспособность ограничителя температуры.

Наличие ошибки F3 говорит о неисправной горелке. Чтобы устранить проблему, следует проверить электроды и соединительные провода.

Ошибка F4 указывает на отсутствие сигнала наличия огня. Следует проверить соединительные кабели и электроды розжига.

F5 говорит о неисправности топочного автомата – скорее всего, реле давления при включении горелки закрыто либо оно не закрывается при достижении оптимальной частоты движения. В этом случае необходимо проверить дымоход и наличие в нем тяги, шланг и реле давления воздуха, а также соединительные провода.

Ошибка F6 выходит, если произошло срабатывание узла опрокидывания тяги 10 раз на протяжении 24 часов. Требуется проверить наличие тяги в дымоходе.

F8 – регулирующая арматура закрывается с задержкой. Для ликвидации проблемы необходимо провести диагностику арматуры и обоих кабелей.

Ошибка F9 – управление модуляционным клапаном неисправно. Следует вызвать специалиста для проведения диагностики.

Коды 30 и 38 указывают на блокировку горелки. Причинами этого обычно являются:

  • замыкание отопительного термистора;
  • обрыв провода температурного датчика.

В этом случае необходимо провести диагностику термистора или проверить проводку датчика.

Ошибка 50 актуальна только для одноконтурной модели. Она означает замыкание температурного датчика отопительного контура. Следует проверить контакты датчика либо заменить его на новый. 51 – не работает термистор горячей воды. Проверить контакты элемента или заменить его.

Конденсационные газовые котлы Viessmann –конструкционные особенности и цена

Конденсационные газовые котлы отопления – как сэкономить до 30% газа

Узнайте здесь, каким должен быть лучший двухконтурный газовый котел?

Код 58 означает обрыв контактов температурного сенсора. Следует проверить подвод контактов. 59 – отсоединился или сломался термодатчик ГВС. Требуется проверить проводку датчика или заменить сломанный элемент на новый.

Код неисправности b0 означает, что контроллер опрокидывания тяги замкнулся. Следует вызвать мастера сервисной службы.

b8 – обрыв температурного датчика дыма. Требуется наладить проводку.

0А – срабатывание датчика давления газа. Необходимо проверить давление топлива в системе. Если оно ниже нормы, обратиться в газопоставляющую компанию.

0Е – превышение температуры теплоносителя выше 84ºC. Следует убедиться в работоспособности температурного датчика отопительной системы.

0С – низкое напряжение в сети.

Помимо ошибок на экране высвечивается индикация режимов:

  • 03+SERV – активация режима заполнения;
  • температура, индикация + SERV – включен режим «Трубочист» (работа на минимальной мощности).

Коды поломок модели Viessmann Vitogas

Среди напольных газовых котлов Viessmann потребители часто выбирают модель Vitogas. Коды ошибок, которые могут возникнуть на экране и методы их устранения, приведены в таблице.

Коды неисправностейОбозначениеКак устранить
0FРаботает режим регулировки
10Указывает на температуру снаружи 0ºC.

Сломан термистор

Проверить работоспособность наружного термодатчика.

Заменить неисправный термистор или датчик

18Указывает на наружную температуру 0ºC.

Температурный датчик разомкнут

20Замкнуло температурный датчик подачиСломанную деталь нужно заменить
28Регулировка проводится без участия термистораПовреждена проводка температурного контроллера
40Замкнуло температурный датчик при подаче холодной воды из смесителяДиагностика датчика и его контактов. Замена поврежденного элемента.
50Поломка водонагревательного сенсора
51Неисправность термистора в водонагревателе.
58, 59Обрыв проводки бойлераПроверка проводки соединения с бойлером
60Короткое замыкание
70Закоротило E3B
90-91Произошло короткое замыкание в термоконтроллере
9FСбои в контроллере гелиоустановкиДиагностика элемента, при необходимости замена сломанного контроллера
Гелиоустановка мало расходует объем.

Сработало термореле

Диагностика элементов
Ь0Короткое замыкание в датчике дыма
Ь1Проблемы с проводкой панели управления
Ь5, Ь9Внутренняя ошибка
Ь7Агрегат управляется терморегулятором. Неисправность кодирующего штекера устройства
ЬАОшибка связи комплекта привода смесителя для контура отопления со смесителем
bbПроблемы с проводкой комплекта при­вода смесителя для отопительного контура со смесителем
bFНеисправности в телекоммуникационном модуле
С1Ошибка связи модуля расширения ЕА1Вызвать специалиста сервисного центра
С2Обрыв шины КМ-BUS к модулю управления гелиоустановкой
CFСбой в телекоммуникационном модуле
d6, d7, d8Входы на модуле расширения сообщает об ошибке
dAЗамыкание температурного датчика помещения, контур отопления 1 без смесителяСледует заменить неисправную деталь или подтянуть оборванную проводку
dbЗамыкание температурного датчика помещения, контур отопления 2 со смесителем
dCЗамыкание температурного датчика помещения, контур отопления 3 со смесителем
ddНарушение цепи термодатчика контура 1 без смесителя
dEОбрыв цепи термодатчика контура 1 со смесителем
dFОбрыв цепи термодатчика контура 1 со смесителем

Газовый котел Viessmann имеет множество различных функций и довольно сложное устройство. Поэтому, если вы не имеете представление о внутреннем соединении узлов, лучше вызвать мастера сервисного центра, который быстро обнаружит проблему и отремонтирует агрегат.

Газовый котел Висман — коды ошибок: что они означают и что делать для устранения неисправности?

2017-05-18 Евгений Фоменко

Устройство и принцип работы котлов Висманн

Газовые конденсационные котлы Viessman

Отопительное оборудование фирмы Виссман, работающее на природном газе представлено сериями VItodens и Vitocrossal. Рассмотрим основные узлы и принцип работы аппаратов.

Настенные котлы Висман VItodens выпускаются с одним контуром и комбинированные. Оборудованы сенсорным жидкокристаллическим экраном с подсветкой, который располагается на панели управления внизу корпуса. На нем котел Висман показывает режимы работы и коды ошибок во время некорректной работы аппарата.

Более мощные модели оснащены регулятором Vitotrinic с цветным графическим дисплеем и возможностью управления со смартфона. Там же расположен манометр, ручки регулировки и кнопка включения. Подводка труб с теплоносителем и газа осуществляется снизу.

Вверху находится теплообменник Inox-Radial, изготовленный из нержавеющей стали, на который производитель дает гарантию 10 лет. Под ним установлена модулируемая цилиндрическая горелка MatriX с регулятором мощности Lambda Pro Control.

Слева расположен мембранный расширительный бак, который компенсирует расширение теплоносителя при нагревании. Под горелкой есть бесшумный вентилятор с настраиваемой скоростью вращения. Еще ниже установлен циркуляционный насос.

В комбинированных моделях слева внизу стоит дополнительный пластинчатый теплообменник для обеспечения горячего водоснабжения. Аппарат 242-F имеет собственный бойлер косвенного нагрева в нижней части и возможность подключения гелиоустановки. Имеется возможность каскадного подключения оборудования для достижения большей суммарной мощности.

Котел Viessman 242-F

Конденсационные котлы используют не только тепло, выделяемое при сгорании топлива, но и энергию пара, который находится в дымовых газах. Это позволяет увеличить производительность отопительного оборудования и достичь нормативного КПД до 98%.

Низкотемпературные газовые котлы Viessman

Низкотемпературные газовые котлы позволяют регулировать температуру теплоносителя в зависимости от внешней температуры. Представлены моделями Wiessman Vitopend 100 W, Vitogas, Vitorond и Vitoplex.

Аппарат Виссман Витопенд 100 В с одним контуром оборудован системой Aqua-Block с мультиштекерным соединением Multi-Stecksystem от фирмы Grundfos. Производится в двух исполнениях с камерой сгорания закрытого типа (модель «турбо») и с забором воздуха для горения из помещения (модель «Атмо»). Турбированный котел оборудован коаксиальным дымоходом и вентилятором со сниженным уровнем шума для выведения сгоревшего топлива.

Для обеспечения ГВС дополнительно следует приобрести водонагреватель косвенного типа Vitocell 100-W. Котел Висман 100 Wh2B оборудован интегрированной функцией защиты от замерзания и системой диагностики.

В серии Vitogas поверхности нагрева в теплообменнике изготовлены из специального серого чугуна с пластинчатым графитом, обладают низкой тепловой нагрузкой на поверхность нагрева. Стержневая горелка изготовлена из нержавейки с частичным предварительным смешиванием и возможностью дооборудования системой Renox. Под кожухом располагается слой высококачественной теплоизоляции.

Основные коды ошибок

Ошибка 03 возникает при сбое в работе контроллера.

Автоматика котла Viessmann Vitola 200

Ошибка 0с (oc) выявляет низкое напряжение в электросети. Если вы знаете о нестабильном напряжении в вашей сети, советуется установить стабилизатор, что делать желательно еще до установки котла.

Ошибка b7 означает некорректную работу кодирующего штекера котла и показывает, что котел управляется терморегулятором.

Ошибка d1 появляется при неработающей горелке и значит, что котел отключился и постепенно остывает.

Ошибка f2 (ф2) указывает на неисправность горелки и означает, что сработал ограничитель температуры. Для устранения ошибки необходимо проверить уровень наполненности отопительной установки, осмотреть циркуляционный насос. Также проверяются провода подключения и сам ограничитель температуры. В конце котел нужно перезагрузить.

Ошибка f4 (ф4) показывает, что горелка неисправна. Аппарат выдает ошибку при отсутствии сигнала наличия пламени в горелке. Надо проверить электроды ионизации и розжига, а также кабели, которые к ним ведут. Также осматривается трансформатор зажигания и газовая регулирующая арматура.

Схема котла Viessmann Vitola 200

Ошибка f5 (ф5) значит неисправность газового топочного автомата. Выдается когда закрыто реле давления воздуха при пуске горелки. Надо осмотреть шланг и исправность реле давления воздуха.

Ошибка fc выявляет, что горелка заблокирована, что означает неисправность контроллера управления вентилятора. Следует проверить устройство управления и соединительный кабель вентилятора и при необходимости заменить их.

Другие неисправности

Если ваш котел без дисплея, то ориентироваться на код ошибки не получится. Также ряд проблем возникает еще до начала работы электронной части.

Аппарат может совсем не включаться по следующим причинам:

  • Отсутствует напряжение в сети . Проверьте подключение провода питания, положение выключателя на контроллере и предохранитель.
  • Слишком горячая вода в котле . Подождите, пока вода остынет минимум на 20 градусов и попробуйте снова.
    Датчик тяги котла Висманн
  • Сработал датчик опрокидывания тяги . Подождите 20 минут. Если устройство не заработает, проверьте дымовую трубу, трубу газохода и исправность устройства контроля опрокидывания тяги.
  • Проверьте наличие штекера перемычки CN2 и датчика опрокидывания тяги.
  • Выключился защитный ограничитель температуры . Следует нажать деблокирующую кнопку на панели управления.

После ремонтных работ следует перезагрузить котел, выключив его и снова включив или переведя положения регулятора в состояние «RESET».

Диагностика ошибок и неполадок газового котла Висман Витопенд

Ошибка F4

Она показывает, что не работает розжиг. Сигнализирует о неполадке в приборе ионизационный датчик пламени. Этот компонент выявляет присутствие пламени и прекращает функционирование котла Viessmann Vitopend при ограниченном горении основного газогорелочного устройства либо при перебое поступления газа. Режим работы прекращается по прошествии 3-х неудачных включений. Чтобы вернуться к работе, надо держать нажатой кнопку Reset. Поломка клапана газа – Действиями клапана газа управляет плата электроники. Диагностику этого компонента проводят путем определения величины сопротивления и напряжения. В случае, если значения отличаются от стандартных параметров, нужно заменить клапан. Нет поступления газа в систему – В устройстве газораспределения установлен вентиль, перекрывающий подачу газа. В следствии этого, неисправность в момент включения котла может возникать ввиду закрытого вентиля. Неудовлетворительный контакт либо нет сигнала с ионизационного датчика пламени. Неисправна электронная плата – Когда процесс разжигания выполнен корректно, однако прибор при этом тут же погасает, то возможно, электроника не фиксирует пламя. Исходя из этого, требуется произвести ее проверку.

Ошибка F2

Перегревание теплообменника котла Висман Витопенд. Возникает остановка агрегата. Вступил в действие предохранительный термостат перегрева – Термостат перегрева как и температурный датчик, в большинстве случаев установлены на выходной трубе первичного теплообменника. Функциональная задача термостата – обеспечение защиты прибора от повышенной температуры. Сбой появляется из-за проблем в термостате, температурном датчике, а кроме того при нарушении работы основного циркуляционного контура. Неполадки с датчиком температуры – На электронную плату поступает неправильный сигнал либо плохой контакт между платой управления и датчиком. Неисправен термостат перегрева – В случае, если термостат исправен, но выявлен фактический перегрев теплоносителя, то, видимо, случилась проблема с циркуляцией теплоносителя основного контура. Забился главный теплообменник или элемент фильтра основного контура (слабая циркуляция означает повышенную температуру нагревания жидкости). Повреждение насоса циркуляции или возникла воздушная закупорка в отопительной системе.

Ошибка 06

Она сигнализирует о низком давлении внутри системы. Главные причины, вследствие которых появляется данный сбой: уменьшение давления жидкости в системе отопления. Нарушен контакт между датчиком давления и электронной платой. Неисправно реле давления. В первую очередь следует проверить значения манометра. Во многих случаях сбой исключают посредством подпитывающего крана, который предназначен в целях наполнения теплоносителем отопительной системы. Если авария возобновляется, то вероятней всего, присутствует утечка жидкости. Течь может гидронасос, основной теплообменник, сбросной клапан, поврежденные прокладки, подпиточный кран и другие компоненты. Утечку можно обнаружить при осмотре гидравлических компонентов и соединений.

Код ошибки F5 (E0)

Слабая тяга. В целях надёжного и безопасного функционирования газового котла следует создать тягу для вывода дымовых газов, чтобы не случилось их попадание в жилые помещения. Вывод газов контролирует автоматикой, и когда появляются какие-либо неполадки, включается датчик-реле тяги, и аппарат прекратит работать. Основные источники отсутствия тяги: малогабаритный диаметр дымохода неправильный монтаж, загрязнение, лед на внутренней стенке. Сужение размеров дымохода может являться причиной ослабления тяги. Длина трубы дымохода превышена Советуем тщательно изучить руководство по установке газового котла и проверить соблюдение обязательных требований. Слишком длинный горизонтальный отрезок дымоотводящей трубы может послужить источником отсутствия тяги. Повреждение датчика по тяге – Когда в подводящей трубке происходит разряжение, то можно услышать характерный щелчок. Нарушился контакт между электронной платой и датчиком тяги, имеется конденсат, а также плохое подсоединение трубок к пневмореле. Повреждение деталей вентилятора – В крыльчатке вентилятора возник засор. На вале вентилятора нет смазки, соответственно он не выходит на требуемые обороты. Отсутствие контакта между вентилятором и электронной платой.

Код ошибки F59

Отказ в определении температуры датчиком ГВС. Это обстоятельство свидетельствует о том, что сломался датчик температуры ГВС или поднялась рабочая температура.
Основные факторы появления данной неисправности: термодатчик горячего водоснабжения сломался. Нет контакта между электронной платой и термодатчиком ГВС. Перегорела плата управления. Когда датчик температуры ГВС работоспособен и надежно контактирует с электронной платой, но при этом котел высвечивает ошибку, то, вероятно, электронная плата имеет дефект.

Код ошибки F3

Розжиг не производится. Данный код может возникнуть, когда отсутствует розжиг либо имеется затухание пламени горелки. Необходимо провести проверку соединений между устройством розжига, и электродом пламени, а также между электронной платой и клапаном газа. Главным фактором срыва пламени является недостаточная тяга.

Ошибка F58

Датчик температуры контура отопления работает некорректно. Этот код обозначает неисправность термодатчика контура отопления либо сильно увеличилась рекомендуемая температура. Разрыв в цепи термодатчика контура отопления – Такая неисправность может возникнуть, если нарушен контакт датчика температуры с платой управления, или температурная величина ниже нормы. В течение 5 секунд вслед за определением аварии котел Viessmann Vitopend восстановит безаварийную работу, если неисправность произошла спонтанно. Требуется проверить, что нет влаги на коннекторе датчика и соединителе электронной платы При отсутствии влажности следует выполнить замену датчика. Появление короткого замыкания датчика температуры отопительной воды – Этот сбой возникает в момент короткого замыкания цепи датчика температуры или величина температуры теплоносителя выше рекомендуемой. Сначала рекомендуется сделать замеры сопротивления датчика. В случае, если показатели сопротивления не совпадают с требуемыми, рекомендуется заменить термодатчик. Когда установка нового датчика не дает желаемого результата, отремонтируйте плату.

У меня установлен газовый котел Висман Витопенд 100. В последнее время практически каждый день показывает ошибку по розжигу F4. После перезагрузки клавишей reset аппарат время от времени стартует удовлетворительно, но это бывает эпизодически. Совсем недавно я убрал крышку воздухозабора, и он заработал лучше. Что может быть неисправно?

Если выбивает ошибку, связанную с дымоотведением, требуется открыть крышки защиты. Это поспособствует захвату воздуха из жилого помещения. Вслед за этим осмотреть трубу дымохода на наличие льда и, если он есть, убрать его. Если сбой по отрыву пламени, следует выяснить, есть ли подача газа в помещение.

Часто котел показывает ошибку F58. Кто-нибудь может объяснить, что за неисправность?

Этот код ссылается на поломку температурного датчика контура отопления. Скорей всего, надо заменить его.

Почему перестал включаться котел Viessmann Vitopend 100? При этом периодически начинает выдавать ошибку F2. Как исправить?

Данный сбой может показываться в силу различных проблем в термостате, датчике температуры, а кроме того при нарушениях работы основного циркуляционного контура. По всей видимости, перегревается теплообменник. Если же термостат и датчик температуры не имеют поломок, то проблема в плате управления. Следует поменять ее.

Почему котел не хочет запускаться и выдается ошибка 06? Давление нормально удерживает, утечек не видно. Отключаю от сети, но неполадка не уходит. Помогите, как исправить?

Такая ситуация может показываться при снижении давления жидкости в отопительном контуре. В таком случае советуем проверить датчик-реле минимального давления. Судя по всему, он имеет поломку.

Неполадка прибора следующая: ГВС включено на температуру в сорок пять градусов. Если пользоваться горячей водой, горелка горит недолго и быстро затухает. Этот круговорот возникает регулярно. Из крана вытекает то холодная вода, то теплая. Нередко высвечивает код ошибки Ф2. Из-за чего эта неисправность?

Такой код сигнализирует о перегревании в контуре ГВС. Скорей всего, имеется сильное загрязнение теплообменника, или неверно отрегулирован термостат.

У нас следующая неполадка. при розжиге прибор показывает ошибку F3 (срывает пламя). Когда выполняем перезагрузку, он включается, но едва загорается горелочное устройство, можно услышать странные щелчки, и опять выводится ошибка. Заменил электрод ионизации, промыл датчик протока удалял землю с вилки, но результата нет. Что случилось?

Эта неисправность возникает по трем причинам. Повреждение электрода контроля пламени. Некорректная подача газа. Повреждена электронная плата.

Агрегат автономно прерывал работу и выдается код ОС. Что можно сделать?

Отсутствие теплоносителя в аппарате или же поломка датчика реле давления. Вначале залейте жидкость в систему.

Газовый агрегат прерывает работу с сигналом ошибки Ф5. Чистка и продувка помогла ненадолго. Как быть?

Эта ситуация говорит об отсутствии тяги, и нужно проверить канал отвода дыма. Возможно, что залипла мембрана. В других случаях, необходимо связаться со специалистом для детальной диагностики агрегата с дальнейшим его.

Имеется газовый котел Висман Витопенд 100. Стала вылезать ошибка с кодом F59. Сам аппарат совершает работу, уровень температуры жидкости регулируется вручную. Когда его монтировали, кажется, перегрели, так как включали автоматический режим температуры. Уличного температурного датчика воздуха нет. Из-за чего эта неисправность?

Предполагаем, что поврежден температурный датчик ГВС. В некоторых случаях дает сбой электронная плата.

Прибор работает приблизительно две-три минуты, потом прекращает действовать горелочное устройство, и возникает ошибка с кодом F5. Она мигает не больше минуты, газовая горелка, снова начинает работать, и прибор функционирует приемлемо еще три-четыре минуты, и так много раз. Данный код, исходя из инструкции по эксплуатации, показывает на срабатывание датчика тяги, но дымоход без засоров, дымовые газы отводятся нормально. Не получается выяснить, в чем причина неполадки?

В конкретном случае, основными причинами, способствующими отсутствию тяги, могут являться: неполадки с пневмореле-датчиком тяги. Нет контакта между датчиком-реле тяги и электронной платой. Имеется конденсат, а также неправильное крепление трубок с пневмореле. Повредился вентилятор. Вероятно, он не развивает требуемые обороты.

Коды ошибок газовых котлов Висман

Последовательность операций и возможные неисправности

Вентилятор не запускается спустя прибл. 51 с. Ошибка F5. Проверить реле давления воздуха, вентилятор, соединительные кабели вентилятора, электропитание вентилятора.

Розжига нет – Ошибка F4. Проверить подключение блока розжига.

Газовая регулирующая арматура не открывается – Ошибка F4. Проверить газовую регулирующую арматуру (управляющее напряжение 230 В), проверить динамическое давление газа.

Не создается ток ионизации (свыше 2) – Ошибка F4. Измерить ток ионизации, проверить настройку электрода и наличие воздуха в линии подачи газа.

Горелка не работает – Отключается при температуре ниже установленного значения заданной температуры котловой воды и сразу включается снова. Проверить герметичность системы удаления продуктов сгорания (рециркуляция уходящих газов), проверить динамическое давление газа.

Основные коды ошибок котлов Viessmann

Ошибка 06 – Горелка заблокирована. Давление в установке слишком низкое. Проверить давление в установке. Если потребуется, долить теплоноситель.

Ошибка 0A – Горелка заблокирована. Динамическое давление газа слишком низкое. Проверить давление газа и реле контроля давления газа.

Ошибка 0C – Горелка заблокирована. Напряжение сети слишком низкое. Проверить напряжение сети.

Ошибка CC – Неисправность функции внешнего модуля расширения. Связь между контроллером и внешним модулем расширения прервана. Проверить соединительный кабель между контроллером и внешним модулем расширения.

Ошибка F2 – Горелка в состоянии неисправности. Сработал ограничитель температуры. Проверить уровень наполнения отопительной установки. Проверить насос. Удалить воздух из установки. Проверить ограничитель температуры и соединительные кабели. Одновременно нажимать кнопки MODE и OK, пока не начнет мигать (сброс).

Ошибка F3 – Горелка в состоянии неисправности. Сигнал пламени имеется до пуска горелки. Проверить ионизационный электрод и соединительный кабель. Выключить и снова включить сетевой выключатель или выполнить сброс.

Ошибка F4 – Горелка в состоянии неисправности. Отсутствует сигнал пламени. Проверить электроды розжига/ионизационный электрод и соединительные кабели, проверить давление газа, проверить газовую регулирующую арматуру, розжиг и модуль розжига. Выключить и снова включить сетевой выключатель или выполнить сброс.

Ошибка F5 – Топочный автомат в состоянии неисправности. Реле давления воздуха не разомкнуто при пуске горелки или не замыкается при достижении нагрузки розжига. Проверить систему «Воздух/продукты сгорания», шланги реле давления воздуха, реле давления воздуха и соединительные кабели. Выключить и снова включить сетевой выключатель (выполнить сброс).

Ошибка F6 – Сработало устройство контроля опрокидывания тяги. Проверить датчик опрокидывания тяги.

Ошибка F8 – Горелка в состоянии неисправности. Реле газового электромагнитного клапана блокировано. Проверить реле, газовый электромагнитный клапан и соединительные кабели. Выключить и снова включить сетевой выключатель или выполнить сброс.

Ошибка F10/F18 – Постоянный режим работы. Короткое замыкание датчика наружной температуры или датчика температуры помещения.

Ошибка F30 – Горелка заблокирована. Короткое замыкание датчика температуры. Проверить датчик температуры котла.

Ошибка F38 – Горелка заблокирована. Обрыв датчика температуры котла. Проверить датчик температуры.

Ошибка F50/F51 – Не работает система ГВС. Короткое замыкание датчика температуры емкостного водонагревателя (одноконтурная модель).

Ошибка F58/F59 – Не работает система ГВС. Обрыв датчика температуры емкостного водонагревателя (одноконтурный котел) F50/F51 – Не работает система ГВС. Короткое замыкание датчика температуры емкостного водонагревателя (одноконтурная модель).

Другие ошибки котлов Висман

А0 – Горелка блокирована. Давление газа слишком низкое. Проверить давление газа и реле контроля давления газа.

E0 – Горелка блокирована. Сработало устройство контроля опрокидывания тяги. Проверить газоход. Если устройство контроля опрокидывания тяги в течение 24 ч сработало 10 раз, горелка переходит в режим неисправности (индикация ошибки Ф5).

b0 – Горелка заблокирована. Короткое замыкание датчика контроля опрокидывания тяги.

b8 – Горелка заблокирована. Обрыв датчика контроля опрокидывания тяги.

0F – Обслуживание “0F” отображается только в истории ошибок.

10 – Короткое замыкание датчика наружной температуры.

18 – Обрыв датчика наружной температуры.

30 – Короткое замыкание датчика температуры.

38 – Обрыв датчика температуры.

40 – Короткое замыкание датчика температуры подачи, отопительный контур 2 (со смесителем).

44 – Короткое замыкание датчика температуры подачи, отопительный контур 3 (со смесителем).

48 – Обрыв датчика температуры подачи, отопительный контур 2 (со смесителем).

4С – Обрыв датчика температуры подачи, отопительный контур 3 (со смесителем).

50 – Короткое замыкание датчика температуры емкостного водонагревателя.

52 – Короткое замыкание датчика температуры буферной емкости.

58 – Обрыв датчика температуры емкостного водонагревателя.

5А – Обрыв датчика температуры буферной емкости.

90 – Короткое замыкание датчика температуры 0, подключение к модулю управления гелиоустановкой.

IF-01 – Фактическая температура теплоносителя.
IF-02 – Заданная температура теплоносителя.
IF-03 – Настройка максимальной тепловой мощности.
IF-04 – Фактическая температура воды в контуре ГВС.
IF-05 – Заданная температура воды в контуре ГВС.
IF-06 – Расход воды в контуре ГВС.
IF-07 – Фактическая температура в коллекторе (только в сочетании с модулем внешнего расширения).
IF-08 – Фактическая температура в нижней части емкостного водонагревателя (только в сочетании с модулем внешнего расширения).
IF-09 – Фактическая температура в верхней части емкостного водонагревателя (только в сочетании с модулем внешнего расширения).
IF-10 – Фактическая наружная температура (при работе с датчиком наружной температуры).
IF-10 – Фактическая температура помещения (при работе с датчиком температуры помещения).
IF-11 – Настройка кривой отопления (при работе с датчиком наружной температуры).
IF-11 – Настройка заданной температуры помещения (при работе с датчиком температуры помещения).
IF-12 – Состояние горелки.
IF-13 – Текущее значение тока модуляции.
IF-14 – Текущее значение мощности горелки.
IF-16 – Положение газового электромагнитного клапана (On или OFF).
IF-17 – Состояние вентилятора (On или OFF).
IF-18 – Состояние насоса (On или OFF).
IF-19 – Положение 3-ходового переключающего клапана (для отопления).
IF-21 – Тип котла.

Установлен и подключен котел Viessmann 24 квт. Столкнулся со следующей проблемой. Когда выключено отопление, при включении подачи горячей воды срабатывает ошибка, и загорается сигнальная лампочка. Также за гидроблоком (если не ошибаюсь в названии, к нему еще присоединен циркуляционный насос) из трубки начинает течь вода. В системе отопления сразу же снижается давление. Я предполагаю, что перед этой трубкой должен быть клапан. Подскажите, в чем может заключаться проблема? Рабочее давление 1,8 Атм., все работает отлично, пока не начинает литься вода и падать давление.

В вашем случае возможно срабатывание предохранительного клапана, так как заклинивает циркуляционный насос. Если насос стучит, то нужно его заменить. Также рекомендуем заменить сам предохранительный клапан, особенно если он срабатывает несколько раз подряд (из-за частых срабатываний возможно ухудшение его работы в штатных условиях). Возможно, потребуется замена обоих теплообменников, видимо вы их не чистили, и они сильно забились. При сильном их загрязнении в чистке уже нет смысла.

Газовый настенный котел Висман 100 (закрытая камера сгорания). Установлен примерно в одном метре от стенки. Интересует установка конденсатодатчика, а именно, в каком месте коаксиального дымохода допускается его установка?

Самым оптимальным местом установки является колено 90 градусов.

Подскажите, пожалуйста. Насколько я знаю, конструктивно у газовых настенных котлов Viessmann не предусмотрена установка беспроводных датчиков наружной температуры. Можно ли использовать датчик другого производителя к Vitotronic 200/КО2В?

Более простым конструктивным решением было бы все-таки вывести провод на улицу.

Кирпичный дом площадью 200 кв. м (стены из одного слоя кирпича и дополнительно 10 см пенопласта, а также облицовка дома в полкирпича). На первом этаже требуется отопить 90 кв. м, на втором отопление не проведено. Установлены: теплый пол и радиаторы (керми). В наличии бойлер 200 л, но он на данный момент выключен (экономим газ). Имеется котел Viessmann с автоматикой Vitotronic 100 КС4 35 КВт. Подключено три насоса на теплый пол, радиаторы и бойлер соответственно. На магистрали к теплому полу монтирован трехходовой клапан с регулятором подачи и коллектор. Из-за некоторых финансовых трудностей не получилось закопать газгольдер перед зимой, а магистрали газа нет. На данный момент отапливание осуществляю привозным газом из баллонов. При моем расходе 3 баллона (50 л каждый) хватает на 4-5 дней. В январе месяце на газ потратил 14 т. р. Пробовал прогревать дом только теплым полом, а также пол и радиаторы совместно. Разницы в расходе не заметил. В связи с этим интересует вопрос, можно ли оптимизировать систему и сократить потребление газа. Отмечу, что тактует котел так: горение 150 секунд, режим ожидания 270 секунд. Температура около 50С, на теплый пол подается 40С, работают две батареи. Мне кажется, что слишком короткое время ожидания. Можно ли его увеличить. Даст ли отключение бойлера уменьшение расхода газа? На данный момент в работе электрический с емкостью в 100 литров.

Обратите внимание на возможность отключения теплого пола, и если это возможно реализовать, то поставьте в систему комнатный термостат. У вас установлена автоматика Vitotronic 100 КС4, она позволяет управлять одним прямым контуром и бойлером. Соответственно она работает, ориентируясь на термостат, установленный в агрегате. Так как вы отапливаетесь СУГ, для вас вопрос экономии очень важен, а КС4В для вас не подходит. На
радиаторы должен быть установлен смесительный контур. Также требуется учитывать такой важный параметр как «минимальная температура агрегата». Для газа это 60С. Если реализован прямой контур, то в радиаторы вода с меньшей температурой просто не пойдет. Если зима теплая, то получается, что температура ТН не соответствует уличной. Это очень мощный аппарат, дающий хороший запас, поэтому он так часто и тактует. Также важно учесть, как был реализован перевод агрегата на пропан: правильно ли настроено давление на форсунках. Если пытались уменьшить мощность уменьшая давление, то риск повреждения горелки очень велик. У атмосферного котла всегда открыт дымоход и, следовательно, присутствуют большие теплопотери. Рекомендует выбрать модель закрытого типа, например, Витоденс 100. Он конденсатный и реализован на погодозависимость. Также он отлично подходит для работы на пропане.

Дополнительная информация по моделям газовых котлов: Характеристики, рабочие функции, комплектующие элементы, управление и регулировки, поиск и устранение неисправностей.

Хуанита Висман Candlefaq - Луисвилл, Кентукки

Часто задаваемые вопросы о свечах памяти

Q: Свечи настоящие или просто виртуальные (онлайн) изображения поддержки и дани?

A: Свечи памяти - это онлайн-представления только любви и дани. Никакая физическая свеча не будет зажжена в память о любимом человеке.

Q: Как исправить орфографическую ошибку после покупки свечи?

A: Пожалуйста, свяжитесь с похоронным бюро, чтобы внести поправки.

В: Почему я не вижу нескольких слов в своем сообщении с поминальной свечой?

A: Скорее всего, это связано с разрешением вашего экрана. Минимальные системные требования - 1024 x 768 пикселей.

Q: С кем я могу связаться, чтобы обсудить покупку Memorial Candle?

A: Если в сообщении «Свеча памяти» есть ошибка, обратитесь в похоронное бюро, чтобы внести изменения.Если возникла техническая ошибка, напишите по адресу [email protected]

Q: Как я могу решить проблему с покупкой свечей? С меня были предъявлены обвинения четыре раза, хотя я получил три уведомления об отказе. Компания, выпускающая мою кредитную карту, говорит, что все прошло.

A: InternetSecure, компания по обработке кредитных карт, которая управляет онлайн-транзакциями по кредитным картам, отклонила ваши транзакции. Даже если компания вашей кредитной карты могла быть одобрена, транзакция все равно должна быть одобрена обеими компаниями.На вашей кредитной карте будут отображаться транзакции, однако дополнительные транзакции будут возвращены и указаны в вашей выписке в течение 72 часов.Обратите внимание: FrontRunner Professional НЕ обрабатывает транзакции по кредитным картам. Никакие средства не зачисляются на наши счета, если это не одобрено как компанией-эмитентом кредитной карты, так и InternetSecure.

В: Почему моя свеча не проходит, если компания, выпускающая мою кредитную карту, сообщает, что с моей картой все в порядке?

A: Убедитесь, что вся информация, которую вы вводите, в точности совпадает с информацией, связанной с вашей учетной записью кредитной карты.Имя, адрес и номер телефона должны совпадать с теми, что указаны в компании, обслуживающей вашу кредитную карту.Если ваша кредитная карта является VISA, и вы ввели информацию правильно, ваша карта может быть отклонена, потому что она не настроена как проверяемая VISA. Обсудите эту функцию безопасности напрямую с VISA, а не в своем банке.

В: Что мне делать, если у меня нет адреса электронной почты, но я хочу купить поминальную свечу?

A: Вы можете приобрести памятную свечу без действующего адреса электронной почты, однако квитанция будет отправлена ​​на указанный адрес.Вы можете ввести адрес электронной почты друга или члена семьи, который захочет распечатать вам распечатку квитанции.Обратите внимание: вся информация, введенная для покупки Мемориальной свечи, НЕ распространяется и не используется для массовой рассылки онлайн-предложений. FrontRunner Professional обеспечивает высочайший уровень онлайн-безопасности, чтобы обеспечить безопасность вашей информации.

Q: Как я могу изменить покупку свечей с одной продолжительности / платы на другую?

A: Чтобы изменить вашу Свечу памяти, напишите по электронной почте andrew @ frontrunner360.com и включите следующую информацию:Название похоронного бюро: Имя умершего: Дата покупки: Номер квитанции: Твое имя: Ваша электронная почта:После получения информации ваш заказ будет изменен и подтвержден в течение 2 рабочих дней. Отражение возврата в выписке по кредитной карте может занять до 72 часов.

Q: Когда будет видно мое сообщение со свечой? Я заказал один, но не уверен, был ли он обработан.

A: Сообщение появится, как только транзакция будет обработана / после выдачи квитанции об оплате. Если вы не получили квитанцию, транзакция не была обработана.

Q: Почему мое сообщение не отображается на свече?

A: Возможно, вам потребуется очистить историю / кеш-историю Интернета в веб-браузере. Нажмите клавишу F5 на клавиатуре, но если это не сработает, вам нужно будет удалить свою историю.Поскольку настройки разные для каждого браузера, просмотрите настройки своего браузера и справочную документацию, чтобы определить, как удалить историю.

В: Что мне делать, если моя свеча не появляется, хотя я получил квитанцию ​​об оплате?

A: Отправьте электронное письмо [email protected] со следующей информацией:- Название похоронного бюро - Имя умершего - Номер платежной квитанции - ТОЧНОЕ имя на кредитной карте, которая использовалась для покупки свечи

.

Q: Я заказал не ту свечу и очень хотел бы изменить свой заказ.Есть ли способ сделать это?

A: Чтобы изменить вашу Мемориальную свечу, нам потребуется, чтобы вы отправили следующую информацию по адресу [email protected]: - Название похоронного бюро - Имя умершего - Дата покупки - Номер квитанции - Твое имя - Ваша электронная почтаПосле того, как мы получим эту информацию, ваша поминальная свеча будет заменена и подтверждена в течение 2 рабочих дней. Отражение возврата в выписке по кредитной карте может занять до 72 часов.

Q: Будет ли информация о моей кредитной карте передана / продана каким-либо сторонним компаниям в рекламных целях, таких как реклама, списки контактов и т. Д.?

A: FrontRunner Professional не собирает и не хранит информацию о кредитных картах. Онлайн-страница, на которой вы вводите свою личную информацию, находится на защищенном сайте, управляемом Internet Secure, компанией, зарегистрированной Verisign. Он имеет самые высокие стандарты безопасности и конфиденциальности в Интернете.Вся собранная информация надежно зашифрована и не хранится, не продается и не разглашается каким-либо образом, кроме как для подтверждения транзакции с компанией-эмитентом кредитной карты.

Q: Почему моя кредитная карта по-прежнему отклоняется?

A: Есть много причин, по которым транзакция по кредитной карте не может быть одобрена. Наиболее частые причины: неправильный номер карты; неверный пароль; неверный срок действия, адрес не совпадает с выпиской по кредитной карте; карта заблокирована для использования в электронной коммерции: и владелец карты превысил лимит кредитной карты или приблизился к нему.Пожалуйста, свяжитесь с эмитентом вашей кредитной карты для получения дополнительной информации.

Q: Как мне вернуться, чтобы добавить сообщение соболезнования?

A: Если вы не очистили кэш своего компьютера или не отключили файлы cookie, вы сможете открыть страницу соболезнований и внести какие-либо изменения. Если вы не видите эту опцию, обратитесь в похоронное бюро, чтобы внести изменения.

В. Могу ли я совершать только одну покупку в день с помощью кредитной карты?

A: Вы можете совершать пять транзакций по одной и той же карте в течение 24 часов.

Q: Извещается ли семья обо всех купленных памятниках?

A: Похоронное бюро вместе с семьей определяет предпочтительный способ уведомления (если таковой имеется). Семьи могут войти в Книгу воспоминаний, где они могут видеть все обновления. Также есть возможность получать уведомления по электронной почте.

Q: Есть ли скрытые комиссии? Я получил электронное письмо, в котором подтверждалось, что стоимость памятной свечи составляет 29 долларов.95, но выписка по моей кредитной карте показала, что стоимость была 30,19 долларов.

A: Нет, скрытых комиссий нет. FrontRunner Professional получает всего 29,95 доллара за покупку свечи. Любые дополнительные комиссии взимаются компаниями, выпускающими кредитные карты, или финансовыми учреждениями.

Q: Почему с моей кредитной карты были списаны средства несколько раз, но платежная квитанция показывает отклоненные транзакции?

A: Internet Secure пытается одобрить вашу покупку, но компания, обслуживающая вашу кредитную карту, отклоняет транзакцию.Обычно это вызвано неверной информацией, предоставленной в процессе покупки. Убедитесь, что ваш адрес точно такой же, как в выписке.На вашем счету кредитной карты будет отображаться кредит любых неудавшихся транзакций в течение нескольких рабочих дней.

(PDF) Инициирующие опухоль клетки не обогащены цисплатин-выжившим BRCA1; p53-дефицитные опухолевые клетки молочной железы in vivo

www.landesbioscience.com Cell Cycle 3791

39. Рейя Т., Моррисон С.Дж., Кларк М.Ф., Вайсман Иллинойс. Stem

раковые и раковые стволовые клетки

Nature 2001;

414: 105-11.

40. Дин М., Фоджо Т., Бейтс С. Стволовые клетки опухоли и устойчивость к лекарствам

. Nat Rev Cancer 2005; 5: 275-84.

41. Fillmore CM, Kuperwasser C. Рак груди человека

клеточные линии содержат стволовые клетки, которые самообновляются, дают

фенотипически разнообразное потомство и выживают после химиотерапии.Рак молочной железы Res 2008; 10:25.

42. Ли Х, Льюис М.Т., Хуанг Дж., Гутьеррес К., Осборн К.К.,

Ву М.Ф. и др. Внутренняя резистентность онкогенных

раковых клеток груди к химиотерапии. J Natl Cancer Inst 2008;

100: 672-9.

43. Хубер Л.Дж., Ян Т.В., Саркисян СиДжей, мастер SR, Дэн

CX, Ходош Л.А. Нарушение ответа на повреждение ДНК в клетках

, экспрессирующих муравей Brca1 с делецией 11 экзона мыши, вариант

, который локализуется в ядерных очагах.Mol Cell Biol 2001;

21: 4005-15.

44. Шарма С.В., Ли Д.Й., Ли Б., Куинлан М.П., ​​Такахаши Ф.,

Махесваран С. и др. Опосредованное хроматином обратимое состояние

лекарственной устойчивости в субпопуляциях раковых клеток. Cell

2010; 141: 69-80.

45. Крейтон С.Дж., Ли Х, Лэндис М., Диксон Дж. М., Ноймейстер

В.М., Шолунд А. и др. Остаточный рак молочной железы после

традиционной терапии демонстрирует мезенхимальные, а также

опухолевые признаки.Proc Natl Acad Sci USA

2009; 106: 13820-5.

46. Jonkers J, Meuwissen R, van der Gulden H, Peterse H,

van der Valk M, Berns A. Синергетический опухолевый супрессор

активности BRCA2 и p53 в условной модели рака груди у мышей

. Nat Genet 2001; 29: 418-25.

47. Роттенберг С., Паджик М., Йонкерс Дж. Изучение лекарственной устойчивости

с использованием генно-инженерных моделей мышей для

рака груди. Методы Мол Биол 2010; 596: 33-45.

48. Zander SA, Kersbergen A, van der Burg E, de Water

N, van Tellingen O, Gunnarsdottir S, et al. Чувствительность

и приобретенная устойчивость BRCA1; p53-дефицитные опухоли молочной железы мыши

к ингибитору топоизомеразы I

топотекан. Cancer Res 2010; 70: 1700-10.

49. Александр С.М., Пухальски Дж., Клос К.С., Баддерс Н., Аиллес

Л., Ким К.Ф. и др. Разделение стволовых клеток с помощью проточной цитометрии

etry: снижение вариабельности для твердых тканей.Cell Stem

Cell 2009; 5: 579-83.

29. Zhang M, Behbod F, Atkinson RL, Landis MD,

Kittrell F, Edwards D, et al. Идентификация опухолевых клеток-инициаторов

в мышиной модели рака молочной железы

на мышах с нулевым р53. Cancer Res 2008; 68: 4674-82.

30. Аль-Хадж М., Вича М.С., Бенито-Эрнандес А., Моррисон

С.Дж., Кларк М.Ф. Проспективная идентификация опухолевых

генных клеток рака молочной железы. Proc Natl Acad Sci USA 2003;

100: 3983-8.

31. Эйрев П., Стингл Дж., Рауф А., Турашвили Г., Апарисио С.,

Эмерман Дж. Т. и др. Метод количественного определения нормальных

эпителиальных стволовых клеток молочной железы человека с регенеративной способностью

in vivo. Nat Med 2008; 14: 1384-9.

32. Рауф А., Чжао Ю., То К., Стингл Дж., Делани А., Барбара

М. и др. Транскриптомный анализ процесса коммитирования и дифференцировки нормальных клеток молочной железы человека

. Cell Stem Cell 2008; 3: 109-18.

33. Shackleton M, Vaillant F, Simpson KJ, Stingl J, Smyth

GK, Asselin-Labat ML, et al. Генерация функциональной молочной железы из одной стволовой клетки. Nature

2006; 439: 84-8.

34. Слиман К.Е., Кендрик Х., Эшворт А., Исак С.М.,

Смолли М.Дж. Окрашивание CD24

клеток молочной железы мыши определяет люминальные эпителиальные, миоэпителиальные / базальные и

неэпителиальные клетки. Рак молочной железы Res 2006; 8: 7.

35.Раймонд К., Дюнье М.А., Фаральдо М.М., Глухова

МА. Адгезия в нишах стволовых клеток. Curr Opin

Cell Biol 2009; 21: 623-9.

36. Taddei I, Deugnier MA, Faraldo MM, Petit V, Bouvard

D, Medina D, et al. Делеция интегрина бета1 из

базального компартмента эпителия молочной железы затрагивает

стволовых клеток. Nat Cell Biol 2008; 10: 716-22.

37. Роуленд Т.Дж., Миллер Л.М., Блашке А.Дж., Досс Е.Л.,

Бонэм А.Дж., Хикита С.Т. и др.Роль интегринов в индуцированном человеком росте плюрипотентных стволовых клеток

на матригеле и витронектине

. Stem Cells Dev 2009; [Epub

перед печатью].

38. Кинтана Э., Шеклтон М., Сабель М.С., Фуллен Д.Р.,

Джонсон Т.М., Моррисон С.Дж. Эффективное опухолевое образование

одиночными клетками меланомы человека. Природа 2008;

456: 593-8.

18. Кларк М.Ф., Дик Дж. Э., Диркс П. Б., Ивз С. Дж., Джеймисон

СН, Джонс Д. Л. и др. Раковые стволовые клетки - перспектива

о текущем состоянии и будущих направлениях: AACR

Семинар по раковым стволовым клеткам.Cancer Res 2006;

66: 9339-44.

19. Rosen JM, Jordan CT. Возрастающая сложность парадигмы

раковых стволовых клеток. Наука 2009; 324: 1670-3.

20. Visvader JE. Идти в ногу с эпи

телиальной иерархии молочной железы и туморогенезом молочной железы. Genes Dev

2009; 23: 2563-77.

21. Чо Р. В., Ван X, Дин М., Шедден К., Чен Г. Ю.,

Шерлок Г. и др. Выделение и молекулярная характеристика

раковых стволовых клеток в опухолях молочной железы мыши MMTV-Wnt-1

.Стволовые клетки 2008; 26: 364-71.

22. Ginestier C, Hur MH, Charafe-Jauffret E, Monville

F, Dutcher J, Brown M, et al. ALDh2 является маркером

,

нормальных и злокачественных стволовых клеток молочной железы человека, а

- предиктором плохого клинического исхода. Cell Stem Cell

2007; 1: 555-67.

23. Wright MH, Calcagno AM, Salcido CD, Carlson MD,

Ambudkar SV, Varticovski L. Опухоли молочной железы Brca1

содержат отдельные клетки CD44 + / CD24- и CD133 +

с характеристиками раковых стволовых клеток.Рак молочной железы Res

2008; 10:10.

24. Стингл Дж., Эйрев П., Рикетсон И., Шеклтон М., Вайллант

Ф, Чой Д. и др. Очистка и уникальные свойства -

связей эпителиальных стволовых клеток молочной железы. Природа 2006;

439: 993-7.

25. Донту Дж., Абдаллах В. М., Фоли Дж. М., Джексон К. В.,

Кларк М. Ф., Кавамура М. Дж. И др. Размножение

in vitro и профилирование транскрипции стволовых клеток молочной железы человека /

клеток-предшественников. Genes Dev 2003; 17: 1253-70.

26. Шафи Н., Смит С.Р., Вей С., Ким И., Миллс Г.Б.,

Хортобаджи Г.Н. и др. Раковые стволовые клетки вносят вклад

в устойчивость к цисплатину в опухолях молочной железы у мышей, опосредованных Brca1 / p53,

. Cancer Res 2008; 68: 3243-50.

27. Василопулос А., Ван Р., Петровас С., Амброзак Д.,

Коуп Р., Дэн С.Х. Идентификация и характеристика

инициирующих рак клеток из BRCA1 родственных опухолей молочной железы

с использованием маркеров нормальных стволовых клеток молочной железы

.Int J Biol Sci 2008; 4: 133-42.

28. Teissedre B, Pinderhughes A, Incassati A, Hatsell

SJ, Hiremath M, Cowin P. MMTV-Wnt1 и

-DeltaN89beta-catenin индуцируют канонический сигнал-

ing в различных предшественниках

000 и дифференциально активируют

сигнализация в опухолях молочной железы. PLoS

One 2009; 4: 4537.

HUA ENHANCER3 раскрывает роль циклин-зависимой протеинкиназы в спецификации идентичности органов цветка у Arabidopsis

Резюме

У растений органы образуются постэмбрионально из высокоорганизованных структуры, известные как меристемы.Деление клеток в меристеме близко интегрированы со спецификацией клеточной судьбы и образованием органов. Наличие множественные циклин-зависимые киназы (CDK) и их партнерские циклины в растениях и других многоклеточных организмов, вероятно, отражает сложность клеточного регуляция цикла в контексте развития. Арабидопсис геном кодирует не менее восьми CDK и 30 циклинов. Однако мутантов нет ни в одной Сообщалось о CDK, и функция подавляющего большинства этих генов в развитии растений неизвестно.Мы показываем, что HUA ENHANCER3 (HEN3), который кодирует CDKE, гомолог CDK8 млекопитающих, необходим для определения идентичности тычинок и плодолистиков и для правильного прекращение стволовых клеток в цветочной меристеме. Следовательно, CDK8 играет роль в дифференцировке клеток в многоклеточном организме.

Введение

Апикальная меристема побега (SAM) служит основным источником надземная биомасса растений. Клетки в центральной зоне SAM являются стволовыми. клетки, которые поддерживают недифференцированное состояние, в то время как клетки периферических зоны участвуют в формировании органов и со временем приобретают различные идентичности.Деление клетки в меристеме должно быть тесно связано с судьбой клетки. спецификация и формирование органов. SAM генерирует цветочные меристемы после цветочный переход. Цветочная меристема, как и SAM, дает начало латеральной органов (чашелистики, лепестки и тычинки), но, в отличие от SAM, оканчивается гинецей. У Arabidopsis прекращение стволовых клеток в цветочная меристема требует AGAMOUS (AG), MADS-домена фактор транскрипции (Bowman et al., 1989; Яновский и др., 1990). AG подавляет выражение WUSCHEL (WUS), ген поддержания стволовых клеток, во временном цветочная меристема (Laux et al., 1996; Ленхард и др., 2001; Lohmann et al., 2001). AG также играет роль цветочных органов. Технические характеристики. В качестве гена цветочного гомеоза класса C AG определяет тычинки идентичность вместе с генами класса B и SEPALLATA (SEP) и идентичность карпеля вместе с генами SEP (Коэн и Мейеровиц, 1991; Мейеровиц и др., 1991; Пелаз и др., 2000).

В дополнение к AG, несколько генов, которые действуют в контроле тычинок и идентичность плодолистика и цветочная детерминированность были идентифицированы с помощью сенсибилизированные генетические экраны.Рецессивные мутации в HUA1 и HUA2, hua1-1 и hua2-1, соответственно, были выделены в качестве энхансеров слабый аллель ag-4 (Чен и Мейеровиц, 1999). hua1-1 hua2-1 цветы двойных мутантов показать частичную трансформацию плодолистика в чашелистик и случайную трансформацию тычинки в лепесток, фенотипы, указывающие на частичную потерю активности класса C (Chen et al., 2002; Чен и Мейеровиц, 1999; Western et al., 2002). В генетический скрининг на фоне hua1-1 hua2-1, рецессивные мутации в HUA ENHANCER1 (HEN1), HEN2, HEN4 и ПРИОСТАНОВЛЕННЫЙ (PSD), как было обнаружено, усиливает слабый цветочный гомеотический эффект. фенотипы цветков hua1-1 hua2-1, такие, что тычинки трансформируются лепестки и плодолистики частично трансформируются в чашелистики (Чен и др., 2002; Cheng et al., 2003; Ли и Чен, 2003; Western et al., 2002). В Все гены HUA и HEN прямо или косвенно способствовать экспрессии AG - у курицы hua1-1 hua2-1 мутанты, AG РНК или белок имеют меньшее количество, чем у дикого типа или в hua1-1 hua2-1 (Cheng et al., 2003; Ли и Чен, 2003 г.). HUA1 и HEN4 физически взаимодействуют в ядре, и вместе с HUA2 и HEN2 способствуют экспрессии AG, предотвращая производство альтернативных транскриптов, содержащих интронные последовательности (Cheng et al., 2003). HEN1 необходим для накопления микроРНК и может модулировать Экспрессия или активность AG посредством регуляции APETALA2, a ген класса A (Park et al., 2002; Чен, 2004)). В этом исследовании мы показываем, что HEN3, кодирующий CDK E-типа, также действует в пути AG.

CDK представляют собой семейство сериновых / треониновых протеинкиназ, которые контролируют клетки. прогрессирование цикла и / или координация прогрессирования клеточного цикла с транскрипцией регулирование. Для полностью активного состояния им требуется как ассоциация с регуляторные субъединицы, циклины и фосфорилирование консервативного треонина остаток CDK-активирующих киназ (САК) (обзор Кобор и Гринблатт, 2002; Морган, 1997).Среди девяти известные CDK (CDK1-CDK9) у позвоночных, Cdc2 (CDK1) и CDK2 осуществляют центральную функции клеточного цикла (обзор Morgan, 1997). Считается, что CDK4 и CDK6 объединяют сигналы и сигналы окружающей среды в клеточный цикл, чтобы вести клетки через Переход G1-S. Комплексы циклин D / CDK4 и циклин D / CDK6 фосфорилируют белок ретинобластомы (Rb), который делает Rb неспособным связываться с E2F и связанных факторов транскрипции, что позволяет им активировать необходимые гены для прогрессирования S-фазы (рассмотрено Харбор и Дин, 2000).У растений есть белки, связанные как с Rb (RBR), так и с E2F. (де Вейлдер и др., 2002; Huntley et al., 1998; Мариконти и др., 2002; Xie et al., 1996), но не имеют ортологи CDK4 или CDK6 (Dewitte и Мюррей, 2003; Vandepoele et al., 2002). Три CDK, CDK7, CDK8 и CDK9, работают в транскрипционная регуляция. CDK7 находится в комплексе TFIIH, где он фосфорилирует C-концевой домен (CTD) самой большой субъединицы РНК полимераза II, способствующая удлинению транскрипции (Кобор, Гринблатт, 2002).CDK9 / cylin T относится к положительному фактору элонгации транскрипции b (P-TEFb) комплекс, который фосфорилирует CTD, чтобы способствовать транскрипции удлинение (де Фалько и Джордано, 2002).

В клетках млекопитающих CDK8 / циклин C является компонентом РНК-полимеразы II. холоэнзим и служит репрессором транскрипции посредством двух механизмов. Он фосфорилирует субъединицу циклина H TFIIH, и это приводит к подавление способности TFIIH активировать транскрипцию и ингибирование CTD-киназной активности CDK7 (Акулитчев и др., 2000). Это также фосфорилирует CTD РНК-полимеразы II до образования преинициативный комплекс, приводящий к ингибированию транскрипции (Ляо и др., 1995; Рикерт и др., 1996; Sun et al., 1998). Хотя функции развития CDK8 у высших эукариот в настоящее время неизвестно, белки CDK8 дрожжей и Dictyostelium, по-видимому, действуют в дифференцировка клеток в ответ на условия питания. Srb10p, дрожжи CDK8, регулирует рост нитей в ответ на ограничение питательных веществ. (Нельсон и др., 2003). В Dictyostelium CDK8 необходим для агрегации, что приводит к спороношение при голодании (Takeda et др., 2002).

Геном Arabidopsis кодирует восемь CDK, классифицируемых как A, Типы B, C и E и 30 циклинов, классифицируемых на типы A, B, D и H, по сходству последовательностей между собой и со своими млекопитающими аналоги (Vandepoele et al., 2002). Из четырех типов CDK лучше всего подходят типы A и B. изучал на растениях. CDK типа A регулируют переходы G1-S и G2-M, тогда как CDK типа B контролируют переход G2-M (Hemerly et al., 1995; Magyar et al., 1997; Porceddu et al., 2001). CDKAs имеют мотив связывания циклина PSTAIRE и связаны с циклинами D-типа (Девитт и Мюррей, 2003; Vandepoele et al., 2002). Два CDKC у арабидопсиса имеют общую сигнатуру связывания циклина PITAIRE и другие структурные характеристики с CDK9 млекопитающих. Они взаимодействуют с белки, имеющие общую гомологию с циклиновыми партнерами CDK9, циклином Т и циклин К (Barroco et al., 2003 г.). CDK E-типа с циклин-связывающим мотивом SPTAIRE была первой. обнаружен в люцерне (Magyar et al., 1997), а позже родственная последовательность была идентифицирована в Arabidopsis (Vandepoele et al., 2002). Функция CDKE неизвестна.

Здесь мы показываем, что HEN3 кодирует единственную CDK арабидопсиса E-типа. Мы также показывают, что HEN3 имеет значительное сходство последовательностей с CDK8 и, подобно CDK8, HEN3 проявляет киназную активность CTD. Фенотипическая характеристика Мутанты hen3 демонстрируют, что HEN3 участвует в размножении клеток в листьях и спецификация клеточной судьбы в меристемах цветков. Наши исследования демонстрируют роль CDK8 в дифференцировке клеток в многоклеточном организме.

Материалы и методы

Выделение мутаций hen3

семян hua1-1 hua2-1 мутагенизировали, как описано (Chen et al., 2002). Одноместный M2 были обследованы семьи и три независимых линии с ag-подобными цветочные фенотипы были идентифицированы. Мутации были восстановлены из плодородные братья и сестры. Тесты комплементации с растениями, гетерозиготными по каждому мутация показала, что три аллеля принадлежат одному гену, который мы назвали HEN3. Три строки hen3 были скрещены с hua1-1. hua2-1 трижды, чтобы очистить генетический фон.Хуа1-1 Затем тройные мутанты hua2-1 hen3 были скрещены либо с hua1-1, либо с hua2-1 для получения hua1-1 hen3 или hua2-1 hen3 double мутанты. Затем два двойных мутанта были скрещены друг с другом, чтобы получить одиночные мутанты hen3. В этих скрещиваниях молекулярное генотипирование для hua1-1 и hua2-1 (Чен и Мейеровиц, 1999; Ли и др. al., 2001) способствовали идентификации растений ожидаемые генотипы.

Клонирование HEN3 на основе карты

растения hua1-1 hua2-1 hen3-1 / + (в экотипе Ландсберга) были пересекли hua1-1 hua2-1 (Col), линию, в которой hua1-1 и мутации hua2-1 были внедрены в фон Колумбии.Пятьсот два растения с фенотипами hua1-1 hua2-1 hen3-1 в популяции F2 были использованы для картирования. HEN3 изначально был нанесен на карту близко к HEN4 на хромосоме V с маркерами, используемыми для выделения HEN4 (Cheng et al., 2003 г.). Новые маркеры были разработаны на основе Cereon Genomics. SNP, которые используются для картирования HEN3 в область размером ~ 150 т.п.н., покрытую P1. клоны MBK5, MGI19, MLE2 и MBM17 (см. рисунок S1A на http://dev.biologies.org/supplemental). Мы секвенировали 12 генов-кандидатов в этой области от hua1-1 hua2-1. hen3-1 и обнаружили мутацию C-to-T, которая остановит кодон в At5g63610.Секвенирование At5g63610 из курицы 3-2 и растения hen3-3 обнаружили отдельные мутации G-to-A, которые при аминокислотных заменах R-на-K и G-на-R, соответственно (Рис. 4B). Фрагмент покрытия At5g63610 амплифицировали с помощью ПЦР с праймерами MBK5p7 (5 ' tggttccgttggagaaattgacataaa 3 ') и MBK5p8 (5′gttggtggtaaatagataagactggcagg 3 ′) (см. Рис. S1A на http://dev.biologies.org/supplemental), и клонирован в pPZP211 (Hajdukiewicz et al. др., 1994). Полученная плазмида pHEN3g была трансформирована в hen3-1 и hua1-1 hen3-1, и было обнаружено, что они спасают Дефекты длины кремнезема этих растений (см. рис.S1B в http://dev.biologies.org/supplemental). Чтобы определить, спасает ли клон также hua1-1 hua2-1 hen3-1 цветочные гомеотические фенотипы, растение hua1-1 hen3-1, гемизиготное для Трансген HEN3g был скрещен с hua2-1 hen3-1. Семена F2 высевали на Среда с канамицином для отбора трансгена HEN3g и резистентного к канамицину F2 растения были перенесены в почву и подвергнуты скринингу для выявления растений с цветочными фенотипы, похожие на hua1-1 hua2-1. Три таких завода были получено из 56 растений F2.Затем три растения были генотипированы. для hua1-1 и hua2-1 и подтверждено, что он гомозиготен для обе мутации. Следовательно, эти растения были hua1-1 hua2-1 hen3-1 тройные мутанты, несущие трансген HEN3g. Как выставляли хуа1-1 hua2-1-подобные цветочные фенотипы, трансген спасал цветочные гомеотические фенотипы, обусловленные мутацией hen3-1.

Рис. 4.

HEN3 тесно связан с CDK8. (A) Диаграмма белка HEN3 с домен серин-треонинкиназы представлен овалом.(B) Класталь W выравнивание киназных доменов в HEN3 и CDK8 человека. Идентичные и похожие аминокислоты заштрихованы. Аминокислотные положения и природа трех Аллели hen3 указаны над последовательностями. Циклин-связывающий мотивы HEN3 и CDK8 подчеркнуты. (C) Филогенетический консенсус бутстрапа дерево, включающее девять различных человеческих CDK, CDK8 от Drosophila (DmCDK8), мышь (MmCDK8), Dictyostelium (DdCDK8) и дрожжи (Srb10p), три CDK типа E из растений и CDKA Arabidopsis (AtCDKA).Cdc2MsE и OsAAG46164 представляют собой CDKE из люцерны и риса соответственно. Дерево был построен с использованием метода объединения соседей и бутстраповского консенсуса был сгенерирован из 1000 повторений. Цифры представляют собой процентное соотношение наличие узлов в репликациях. Только домены протеинкиназы из этих белков были использованы в анализе. Клада CDK8 обозначена прямоугольник.

Конструкция плазмиды HEN3

5'- и 3'-концы РНК HEN3 определяли с помощью 5 ′ и 3 ′ RACE соответственно.Регистрационный номер GenBank для КДНК HEN3 - AY600243.

Для создания репортерной конструкции HEN3-GUS была выпущена кассета GUS-NOS. из pBI121 с помощью EcoRI / BamHI и клонировали в pPZP211 в сгенерировать pPZP211-GUS. Кодирующая область HEN3 плюс 1,5 т.п.н. последовательностей перед стартовым кодоном амплифицировали с праймерами MBK5p7 и MBK5P10. (5'gaggcgtctggatttgttaggaggt 3 ') и клонировали в pPZP211-GUS. В Полученную плазмиду pPZP211-HEN3-GUS трансформировали в Ler и hen3-1 растения. Конструкция в значительной степени спасла курицу3-1 вегетативные дефекты.Трансформанты Ler использовали для определения профили экспрессии HEN3 при окрашивании GUS.

Кодирующая область HEN3 плюс 1,5 т.п.н. последовательностей перед стартовый кодон был клонирован в pPZP211-HA для обеспечения метки HA на C-конце HEN3. Полученная плазмида pPZP211-HEN3-HA была трансформирована в hen3-1, и было обнаружено, что они в значительной степени спасают кремневые дефекты hen3-1 (Рис. S1B на http://dev.biologies.org/supplemental). Эти растения hen3-1 HEN3-HA использовали для иммунопреципитации HEN3-HA в анализ протеинкиназы.

Гибридизация РНК-фильтра и сканирующая электронная микроскопия (СЭМ)

Гибридизацию с фильтром РНК

проводили, как описано (Ли и др., 2001). Общая РНК (40 мкг) использовали для обнаружения РНК AG и AP1. РНК PolyA + (1 мкг) использовали для обнаружения РНК HEN3. Сигналы гибридизации количественно оценивали с помощью фосфорного сканера.

SEM проводили, как описано ранее. (Chen et al., 2002).

Экспрессия белка в E.кишечная палочка

C-концевой домен (CTD) самой большой субъединицы РНК-полимеразы II из Arabidopsis (Dietrich et al., 1990) амплифицировали с помощью ОТ-ПЦР с использованием праймеров CTDp1 (5'-CCTGGATCCAGTCCTACTTCTCCCGGTTACAGT-3 ') и CTDp2 (5'-CCTGGATCCTGGATTGCCAATTCTCACTCTCTT-3 '). Усиленный CTD фрагмент был клонирован в вектор экспрессии E. coli pRSETA, чтобы генерировать pRSETA-CTD. Полипептид CTD, меченный His, экспрессировался в E. coli штамм BL21DE3pLysS и очищенный в соответствии с инструкция производителя (Qiagen).

Гистон h2 был приобретен у Roche (номер по каталогу 0223549). His-GFP был произведен с системой быстрого перевода от Roche (CAT # 3186148).

Анализ киназ

Анализ киназы

проводили в соответствии с методом, описанным Cockcroft. и другие. (Кокрофт и др., 2000). Вкратце, 10 г соцветий растирали в жидкости. азота и суспендировали в 50 мл буфера для экстракции [50 мМ Трис-HCl (pH 7,5), 75 мМ NaCl, 15 мМ EGTA, 15 мМ MgCl 2 , 1 мМ NaF, 0.2 мМ натрия ортованадат, 2 мМ напирофосфат, 60 мМ глицерин-2-фосфат, 1 мМ DTT, 0,1% Твин 20, смесь 1х ингибиторов протеазы (Roche, №1697498)]. В суспензию фильтровали через один слой марли и два слоя miracloth и центрифугировали при 1900 g в течение 20 минут при 4 ° C. Супернатант переносили в новую пробирку и снова центрифугировали. Ну наконец то, 40 мл супернатанта добавляли к 160 мкл 50% анти-HA (или анти-протеина C в качестве контроля) -связанную суспензию матрикса и инкубируют при осторожном вращении при 4 ° C в течение 1 часа.Гранулы осаждали центрифугированием при 120 г в течение 10 минут, трижды промывали промывочным буфером (50 мМ Трис-HCl pH 7,5, 250 мМ NaCl, 5 мМ ЭДТА, 5 мМ NaF, 0,1% Твин 20, 0,5 мМ PMSF), дважды с киназным буфером (50 мМ Трис-HCl pH 7,5, 100 мМ NaCl, 15 мМ EGTA, 1 мМ DTT) и ресуспендировали в 20 мкл аналитического буфера (50 мМ Tris-HCl pH 7,5, 100 мМ NaCl, 10 мМ MgCl 2 , 10 мМ MnCl 2 , 1 мМ DTT, 0,5 мМ PMSF, 0,5 мкг / мкл очищенного His-CTD, 2 мкКи [γ- 32 P] АТФ). Реакционную смесь инкубировали при комнатной температуре. температура в течение 25 минут.Белок His-GFP использовали в качестве отрицательного контроля, в то время как гистон h2 использовался в качестве потенциального альтернативного субстрата. Реакция останавливали добавлением загрузочного буфера SDS-PAGE и кипячением в течение 5 минут. Образцы анализировали с помощью SDS-PAGE.

Результаты

HEN3 необходим для спецификации клеточной судьбы цветков

Мы провели генетический скрининг мутагенеза в hua1-1 hua2-1 фон для поиска генов, действующих в цветочных меристемах, для контроля стволовых клеток окончание и идентичность боковых органов.Мы выделили три рецессивных мутации в гене, который мы назвали HUA ENHANCER3 (HEN3). hen3-1, hen3-2 и hen3-3 все привели к потере идентичность репродуктивных органов и цветочная определенность у hua1-1 hua2-1 фон. В то время как органы третьего оборота были тычинками у дикого типа. и hua1-1 цветы hua2-1, лепестки были преобладающим типом органов в третьем обороте цветков hua1-1 hua2-1 hen3 (Таблица 1, Рис. 1A-D). Хотя стигматичный ткань была обнаружена на некоторых органах четвертого оборота у hua1-1 hua2-1 hen3-1 и хуа1-1 хуа2-1 курица3-2 цветы (Рисунок.1С, Г), все абаксиальные эпидермальные клетки на этих органах показали эпикутикулярные бороздки, похожие на таковые на клетках абаксиальной чашелистики (рис. 1H). Напротив, большинство клеток эпидермального клапана на яичники hua1-1 hua2-1 имели гладкую поверхность, характерную для нормальные клетки клапана яичника (рис. 1G). Число органов четвертого оборота у hua1-1 hua2-1 hen3-1 и hua1-1 hua2-1 hen3-2 цветы были увеличены (Таблица 1). Кроме того, внутренние цветки присутствовали во всех цветках hua1-1 hua2-1 hen3 (Фиг. 1E и данные не показаны).Эти фенотипы предполагают, что HEN3 действует в спецификации идентичность тычинок и плодолистиков и цветочная определенность у Arabidopsis развитие цветов. Аллель hen3-2 - самый тяжелый среди три в цветочных фенотипах - стаминоидные лепестки обнаружены в третий оборот hua1-1 hua2-1 hen3-1 или hua1-1 hua2-1 hen3-3 но не хуа1-1 хуа2-1 курица3-2 цветы (Таблица 1). Нет идентичности органа или дефекты цветочной детерминированности были очевидны у hua1-1 hen3, hua2-1 hen3 или мутанты hen3 (рис. 1F; данные не показаны).Однако все hua1-1 hen3, hua2-1 Двойные мутанты hen3 и одиночные мутанты hen3 получили более короткие стручки и стебли, чем соответствующие генотипы HEN3 (рис. S1 и данные не показаны).

Таблица 1.

Количество цветочных органов в hua1-1 hua2-1, hua1-1 hua2-1 hen3-1 и хуа1-1 хуа2-1 курица3-2

Рисунок 1.

Цветочные фенотипы, вызванные мутациями hen3.(A) Цветок дикого типа с тычинками в третьем обороте (стрелка) и плодолистиками в четвертом обороте. (В) А hua1-1 hua2-1 цветок с тычинками в третьем обороте (стрелка) и плодолистики в четвертом обороте. (C) Цветок хуа1-1 хуа2-1 курица3-1 с лепестки в третьем обороте (стрелка) и увеличенный гинецей с гинофором у основания (стрелка), что указывает на то, что гинецей имеет частичную цветочную персонаж. (D) Цветок хуа1-1 хуа2-1 курица3-2 с лепестками в третьем мутовка (стрелка) и увеличенный гинецей в центре.(E) А хуа1-1 хуа2-1 цветок курицы3-3 с дополнительным цветком в центре (наконечник стрелки). В синие стрелки указывают на три незалитых плодолистика. (F) Цветок курицы 3-1 с нормальная идентичность органа. (G) Клетки эпидермального клапана с гладкой поверхностью из дно яичника hua1-1 hua2-1. (H) Клетки эпидермального клапана из hua1-1 hua2-1 hen3-1 яичник. Клетки имеют эпикутикулярные бороздки. похожи на клетки эпидермиса на чашелистниках. (I) А хуа1-1 хуа2-1 курица3-1 аг-1 цветок. (J) Цветок курицы 3-1 аг-1. Цифры обозначают цветочные мутовки.Чашелистики четвертого оборота в значительной степени преобразованы в лепестки. (К) А clv1-4 цветок. (L) Цветок hua1-1 hua2-1 hen3-1 clv1-4, с огромным количеством недифференцированных клеток в центре. Шкала шкалы: 10 мкм м в G, H; 1 мм в J-L.

В соответствии с цветочными фенотипами, мы обнаружили, что hua1-1 hua2-1 цветки hen3-1 были дефектными в пространственном контроле AP1 экспрессия и временной контроль экспрессии WUS в цветке разработка. РНК AP1 обнаруживается повсюду в цветочном зачатке во время стадии 1-2, но ограничивается двумя внешними цветочными мутовками, начиная со стадии 3 из-за подавления его экспрессии AG во внутренних двух обороты (Gustafson-Brown et al., 1994; Mandel et al., 1992). На этапе 3 паттерны накопления РНК AP1 в hua1-1 цветы hua2-1 были похожи на цветы дикого типа (Чен и Мейеровиц, 1999) (Рис. 2A). Однако в hua1-1 hua2-1 hen3-1 стадия 3 цветков, как у цветов ag-3, РНК AP1 была обнаружена по всему зачатку цветков. (Рис. 2B). Внематочный экспрессия AP1 во внутренних двух оборотах цветков была обнаружена в hua1-1 hua2-1 hen3-1 цветки всех стадий (данные не показаны). WUS экспрессируется в нескольких клетках ниже предполагаемых стволовых клеток в цветочная меристема до стадии 6, когда АГ завершает ее выражение (Mayer et al., 1998). Хотя РНК WUS не наблюдалась на стадии 7 и более старые цветки hua1-1 hua2-1 (рис. 2C), РНК WUS легко обнаруживалась на стадии 7 и старше. hua1-1 hua2-1 hen3-1 (рис. 2D) и hua1-1 hua2-1 hen3-2 (данные не показаны) цветы.

Рис. 2.

Паттерны экспрессии AP1, WUS и HEN3 в растениях. (A, B) Гибридизация in situ на срезах цветков стадии 3 для обнаружения AP1 РНК. (A) Цветок хуа1-1 хуа2-1. (B) А хуа1-1 хуа2-1 курица 3-1 цветок. РНК AP1 находится по всему цветку в хуа1-1 хуа2-1 курица3-1.(C, D) Гибридизация in situ на срезах стадия 9 цветков для обнаружения РНК WUS. (C) Этап 9 хуа1-1 hua2-1 цветок, переставший выражать WUS. (D) Этап 9 hua1-1 hua2-1 hen3-1 цветок, который все еще выражает WUS (стрела). (E-H) Окрашивание GUS трансгенных линий HEN3-GUS. HEN3-GUS находится в разрастающиеся ткани или органы. (E) HEN3-GUS присутствует на кончике корня и зачатки боковых корней. (F) HEN3-GUS присутствует на кончике побега у молодых листья, и у основания растущих листьев. (G) HEN3-GUS присутствует в молодых цветы.(H) HEN3-GUS находится на стадии 7 цветка. (I, J) На месте гибридизация на продольных срезах соцветий дикого типа с использованием либо смысловой (I), либо антисмысловой (J) зонд HEN3. HEN3 РНК обнаруживается на низком уровне по всей меристеме соцветия и в меристеме соцветия. цветочные меристемы. Масштабные линейки: 50 мкм.

HEN3 действует главным образом в пути AG в цветке развитие

Поскольку HEN3 действует аналогично AG в развитии цветов, мы спросили, действует ли HEN3 в пути AG или параллельно путь.Если HEN3 действует строго в пути AG, мы бы ожидайте, что цветы hua1-1 hua2-1 hen3-1 ag-1 идентичны ag-1 цветки всех фенотипов. Действительно, AG-1 был по сути эпистатический к hua1-1 hua2-1 hen3-1 в том, что только органы околоцветника были присутствует в цветках hua1-1 hua2-1 hen3-1 ag-1 (Рис. 1I). Однако там мутовок лепестков оказалось больше, чем мутовок чашелистиков в четверной цветы-мутанты. Чтобы исследовать это дальше, мы сконструировали курицу 3-1. ag-1 и обнаружили, что hen3-1 вызывает частичное трансформация чашелистиков в лепестки в четвертом обороте цветков ag-1 (Рисунок.1J). Это наверное было причина в наличии большего количества лепестков у четверного мутанта. Следовательно, HEN3 имеет функции, частично совпадающие с функциями AG в спецификации идентичности органа. Что касается цветочной определенности, HEN3, а также HUA1 и HUA2, по-видимому, действовали в путь AG, поскольку hen3-1 не увеличивал ag-1 в это фенотип. И AG, и CLV1 контролируют детерминированность цветков. регулируя экспрессию WUS. Однако молекулярная механизмы различаются - в то время как AG репрессирует WUS в временным образом, CLV1 ограничивает домен экспрессии WUS (Schoof et al., 2000). В Фактически, ag-1 усиливает clv1-1 в дефектах цветочной детерминации (Кларк и др., 1993). Если HUA1, HUA2 и HEN3 действуют в пути AG в цветочных определенность, мы ожидаем, что hua1-1, hua2-1 и hen3-1 будут усиливают тяжелый аллель clv1-4 при дефектах детерминированности цветков. Действительно, цветы hua1-1 hua2-1 hen3-1 clv1-4 показали впечатляющие результаты. увеличение цветочной меристемы, так что массивная группа, по-видимому, недифференцированные клетки скопились в центре цветка (Рис. 1L). Этот драматический фенотип не наблюдался ни у hua1-1 hua2-1 hen3-1, ни у clv1-4 (рис.1 КБ) цветы.

Мутации в HEN1, HEN2, HEN4 и PSD все привели к снижение экспрессии AG в фоне hua1-1 hua2-1 (Cheng et al., 2003; Ли и Чен, 2003), который был согласуется с цветочными гомеотическими фенотипами, вызванными этими мутациями. В Мутации hen3 приводят к более тяжелым фенотипам потери С-функции, когда по сравнению с другими куриными мутациями. Мы выполнили РНК-фильтр гибридизация, чтобы определить, приводит ли также мутация hen3-1 в снижении уровней AG РНК на фоне hua1-1 hua2-1.Три РНК AG, РНК1, РНК2 и мРНК AG, могут быть обнаружены в hua1-1 hua2-1 и hua1-1 hua2-1 hen3-1 цветы (Рис. 3A). РНК1 и РНК2 являются второй интрон-содержащий AG РНК, которые не могут генерировать полноразмерные Белок AG (Cheng et al., 2003 г.). Хотя мутации в HEN2, HEN4, HUA1 и HUA2 приводит к увеличению количества РНК1 и РНК2 и сопутствующему снижение количества мРНК AG (Cheng et al., 2003), hen3-1 привел к увеличению численности как интрон-содержащие РНК и мРНК на фоне hua1-1 hua2-1 (Рисунок.3А). Обилие AP1 (рис. 3A) и AP2 (не показан) также был увеличен у hua1-1 hua2-1 hen3-1 цветки по отношению к цветкам hua1-1 hua2-1.

Рис. 3.

Экспрессия AP1, AG и HEN3 в различных генотипах. (А) РНК гибридизация фильтра для исследования уровней РНК AG и AP1 в различные генотипы, как указано. Две РНК AG, содержащие 2-й интрон последовательности обозначены как РНК1 и РНК2. Обилие AP1 и РНК AG обозначены числами под изображениями гелей.(B) Западный блоттинг на тотальные белки соцветий разных генотипов с использованием антисыворотки против AG. ag-3 служит отрицательным контролем. Белок AG изобилие одинаково в hua1-1 hua2-1 и hua1-1 hua2-1 курица 3-1 цветы. Полоса, отмеченная звездочкой, представляет собой перекрестно-реагирующий, не связанный с АГ виды из того же пятна. (C) Гибридизация РНК-фильтра для определения обилие РНК HEN3 из соцветий разных генотипов. В численность по сравнению с диким типом обозначена числами под гелем. изображений.

Гибридизация in situ показала, что время и домен мРНК AG скопление в цветках hua1-1 hua2-1 hen3-1 было нормальным (данные не показано). Содержание белка AG было одинаковым между hua1-1 hua2-1 и hua1-1 hua2-1 hen3-1 цветки (рис. 3Б).

HEN3 кодирует CDKE

Чтобы понять молекулярные функции HEN3, мы клонировали этот ген с картографическим подходом (см. Материалы и методы; Рис. S1). В предсказанный белок HEN3 (At5g63610) имеет значительное сходство последовательности с циклинзависимые протеинкиназы растений и животных (Рисунок.4A, B) и был засекречен как CDK E-типа с циклин-связывающим мотивом SPTAIRE в киназном домене (Joubes et al., 2000; Vandepoele et al., 2002). HEN3 и родственные белки из люцерны и риса в настоящее время являются единственными членами класс Е растительных ЦДК (рис. 4C), для которых неизвестны клеточные или онтогенетические функции. CDK класса E, по-видимому, больше связаны с CDK8 во всем киназном домене. чем любые другие CDK у многоклеточных (рис. 4С). У позвоночных CDK8 в сочетании с циклином C, фосфорилирует CTD самой большой субъединицы РНК-полимеразы II (Ляо и др., 1995; Rickert et al., 1996). Интересно, что HEN3 содержит мотив связывания циклина SPTAIRE, который отличается от мотив SMSACRE из CDK8, но похож на мотив PSTAIRE из растительных CDKAs (Рис. 4B). Завод CDKA больше более близок к человеческим CDK1 (cdc2), CDK2 и CDK3, чем к CDK8 (Рис. 4C).

Чтобы проверить, обладает ли HEN3 протеинкиназной активностью, мы создали трансгенные линии, в которых HEN3 был помечен эпитопом НА в трансляционное слияние под контролем промотора HEN3.В Трансген HEN3-HA смог спасти курицу 3-1 Silique (Рис. S1B на http://dev.biologies.org/supplemental) и дефект удлинения ствола (не показан), предполагающий, что слитый белок был функциональный. Затем мы иммунопреципитировали HEN3-HA из этих растений, используя моноклональное антитело против НА и провели анализ киназы с использованием E. coli, 6 × His-tagged Arabidopsis CTD, 6 × His-GFP и человеческий гистон h2 в качестве субстратов. Anti-HA, но не контрольный иммунопреципитат против протеина C, был способен фосфорилировать 6 × His-CTD, но не 6 × His-GFP или человеческий гистон h2 (Рисунок.5А). Анти-HA иммунопреципитаты из нетрансформированных растений не вызывали CTD фосфорилирование (рис. 5В). Это Ранее было показано, что комплекс Arabidopsis CDKA / циклин D и комплекс табака CDK2a / циклин D3 были способны фосфорилировать RBR кукурузы. in vitro (Бониотти и Гутьеррес, 2001; Накагами и др., 1999). Иммунопреципитат HEN3-HA не может фосфорилироваться. кукуруза RBR (не показана). Следовательно, CDKE имеет отчетливую субстратную специфичность. от ЦДКА. Следует отметить, что мутация hen3-1 удаляет часть киназного домена и hen3-2 и hen3-3 мутации в аминокислотах, которые консервативны среди многих CDK (Рисунок.4B и данные не показаны). Следовательно, вероятно, что киназная активность HEN3 нарушена или отменены у этих мутантов.

Рис. 5.

HEN3 обладает активностью киназы CTD. Трансгенные растения HEN3-HA или контроль Нетрансгенные растения иммунопреципитировали моноклональным анти-НА. антитела, а иммунопреципитат использовали в киназном анализе с 10 мкг очищенный гистон h2, 6 × His-CTD или 6 × His-GFP в качестве субстратов. В положения белков-субстратов показаны звездочками.В количество субстратных белков идентично на каждой дорожке. (A) Анти-HA (полосы 2), но не иммунопреципитат антипротеина C (дорожки 1) от HEN3-HA трансгенные растения проявляют киназную активность на 6 × His-CTD. Гистон h2 и 6 × His-GFP не фосфорилируются иммунопреципитатом против НА. (В) Иммунопреципитат против HA из трансгенных растений HEN3-HA, но не из растения дикого типа фосфорилируют 6 × His-CTD.

HEN3 экспрессируется в пролиферирующей ткани

CDK, участвующих в развитии клеточного цикла, предпочтительно экспрессируются в делящиеся ткани (Девитт и Мюррей, 2003 г.).Чтобы определить, экспрессируется ли HEN3 преимущественно в пролиферирующей ткани, мы произвели трансляционное слияние HEN3 с β -глюкуронидаза (GUS) под контролем промотора HEN3. Эта конструкция слияния была введена в курицу 3-1 и, как было обнаружено, в значительной степени спасают вегетативные фенотипы курицы3-1. Гистохимическое окрашивание на Активность GUS показала, что HEN3 экспрессируется у молодых, предположительно деление, ткань, такая как кончики побегов и корней, зачатки боковых корней, молодые листья и цветы (рис. 2E-H). Мы провели гибридизацию in situ, чтобы определить локализация РНК HEN3 в меристемах соцветий и цветках.РНК HEN3 присутствовала по всей меристеме соцветия, стебель соцветия и молодые цветки (рис. 2I, J). Равномерное присутствие РНК HEN3 в каждой клетке в соцветие и цветочные меристемы указывают на то, что изобилие РНК HEN3 не регулируется зависимым от клеточного цикла образом. Ген CDKE люцерны также экспрессируется на базальном неизменном уровне на протяжении клеточного цикла (Magyar et al., 1997).

Гибридизация с фильтром РНК

показала, что РНК HEN3 присутствует в листья, стебли, корни (не показаны) и соцветия (Рисунок.3С). HEN3 РНК Обильнее был в соцветиях ag-3 (Рис. 3C). Это может означать что HEN3 негативно регулируется AG. Тем не менее повышенное содержание РНК HEN3 в соцветиях ag-3 может просто из-за большего количества пролиферирующей ткани в ag-3 цветы.

HEN3 необходим для размножения клеток в листьях

Мы заметили, что все три аллеля hen3 привели к снижению размера листа (Рис. 6A-C). Этот и тот факт, что HEN3 кодирует CDK, поднял вопрос о том, воспроизводит ли HEN3 прямая роль в делении клеток.Поэтому мы стремились определить, уменьшение размера листа у мутантов курицы 3 было связано с уменьшением количества клеток или размер ячейки. Мы измерили площадь полностью развернутого пятого листа в дикого типа и трех мутантов hen3. Самая суровая курица 3-2 аллель привел к уменьшению размера листа почти на 50% (Рис. 6D). Затем мы выполнили сканирующая электронная микроскопия для изучения адаксиальных эпидермальных клеток листа в четыре генотипа. Хотя эпидермальные клетки листа одного и того же листа могут различаться сильно по размеру клетки во всех генотипах (отсюда большая стандартная ошибка), У мутантов hen3 в среднем клетки были меньше, чем у дикого типа. (Рисунок.6E). В том же блоке области листа, у мутантов hen3 было больше эпидермальных клеток (Рис. 6F). Принимая во внимание различия в размере листа, эти генотипы имеют примерно одинаковое количество клетки в пятых листьях. Таким образом, кажется, что сокращение листа размер, вызванный мутациями hen3, связан с уменьшением размножения клеток, а чем деление клеток. В соответствии с этим мы не наблюдали никаких различий. в морфологии SAM или зачатков листа между Ler и hen3-1 в продольных срезах или методом СЭМ (рис.S2 в http://dev.biologies.org/supplemental). Гибридизация in situ показала, что гистон h5, ген, который, как известно, экспрессируется в зависимым от клеточного цикла образом, аналогичным образом экспрессировалась у дикого типа и SAMs курицы 3-1 и зачатки листьев (см. рис. S2 на http://dev.biologies.org/supplemental).

Рис. 6.

Влияние мутаций hen3 на размер листа и эпидермальные клетки листа размер. (A-C) Отсеченные листья розетки 1-7 (расположены слева направо) от hen3 (вверху) и растения дикого типа (внизу), выращенные бок о бок боковая сторона.(A) hen3-1 и дикий тип. (B) курица3-2 и дикий тип. (C) hen3-3 и дикий тип. Обратите внимание, что первые два листа не затронуты мутациями курицы в такой же степени, как и более поздние листья. В Все мутации hen3 приводят к уменьшению размера листа. (D) Площадь (см 2 ) полностью развернувшегося пятого листа дикого типа и Генотипы hen3. Для каждого генотипа измеряли десять листьев. (E) Площадь поверхности (мкм 2 ) адаксиальных эпидермальных клеток на пятом листе генотипов дикого типа и курицы 3. Количество измеренных ячеек было 95, 141, 173 и 143 для дикого типа, курицы3-1, курицы3-2 и курицы3-3, соответственно.Большая стандартная ошибка во многом связана с внутренним изменение размера клеток на эпидермисе листа. (F) Количество эпидермального покрытия клетки в области 70000 мкм 2 из аналогичных позиций в пятом листья различных генотипов. Измерения проводились на СЭМ-изображениях по три листа от каждого генотипа. Планки погрешностей в D-F представляют собой стандартные ошибки.

одиночных мутантных растений hen3 также имели более короткие стебли и кремнеземов (см. рис. S1B на http: // dev.biological.org/supplemental). Клапанные клетки стручков курицы были короче, чем у дикого типа. (данные не показаны). Рост корней на средах с сахарозой или без нее был аналогичным в растения дикого типа и курицы 3-1 (см. рис. S3 на http://dev.biologies.org/supplemental; данные не показаны).

Обсуждение

HEN3 и CDK8

Филогенетически группы HEN3 с белками CDK8 из дрожжей, Dictyostelium и многоклеточные. У млекопитающих и дрожжей CDK8 образует комплекс с циклином C и фосфорилирует CTD самой большой субъединицы РНК полимераза II (Кобор и Гринблатт, 2002).Статус фосфорилирования CTD динамически контролируются киназами и фосфатазами во время инициации транскрипции и удлинение и, по-видимому, диктует различные роли, которые CTD играет во время транскрипция, которые включают ингибирование или стимулирование транскрипции и привлечение различных белков процессинга РНК к сайтам транскрипции (Oelgeschlager, 2002). В млекопитающих и дрожжей, CDK8 / cyclinC является частью комплекса, который взаимодействует особенно с РНК-полимеразой II и подавляет активированную транскрипцию, я.е. транскрипция активируется специфическими факторами транскрипции (Акулитчев и др., 2000; Sun et al., 1998). HEN3 обладает или связана с киназной активностью, которая фосфорилирует Arabidopsis CTD. Следовательно, возможно, что HEN3, как и CDK8, играет регулирующую роль в транскрипции. В соответствии с отрицательным регуляторная роль HEN3 в транскрипции, количество AG, AP1 и AP2 РНК повышается мутацией hen3-1 в hua1-1 hua2-1 фон. Неизвестно, насколько общий эффект мутации hen3 по транскрипции.Однако ясно, что все гены не затронуты в такой степени, как повышение AG, AP1 и Обилие РНК AP2 оценивали относительно обилия РНК UBQ5. Также возможно, что повышенное содержание AG, AP1 и РНК AP2 обусловлены генетическим взаимодействием между hen3-1 и мутации хуа.

Циклиновый партнер HEN3, гомолог CDK8 у растений, еще предстоит выяснить. определенный. Интересно, что HEN3 содержит мотив, связывающий циклин, который очень аналогичен таковому CDKA, который взаимодействует с циклинами D-типа, которые считаются для интеграции входных сигналов от развития и сигналов окружающей среды в клетку цикл (Мейер и Мюррей, 2000; Riou-Khamlichi et al., 1999). Таким образом, можно предположить, что HEN3 будет партнером Циклины D-типа, хотя CDK8 сотрудничает с циклином C. Циклины C-типа из Описаны Arabidopsis, но геном, по-видимому, содержит минимум два циклина С-типа (At5g48630 и At5g48640). Кроме того, рис C-типа о циклине сообщалось (Yamaguchi et al. др., 2000). At5g48640 не взаимодействовал с HEN3 в дрожжах. двухгибридный анализ (W. Wang и X. Chen, неопубликовано). В отличие от дрожжей двухгибридный скрининг с использованием HEN3 в качестве приманки привел к выделению трех Циклины D-типа, которые могут взаимодействовать с HEN3 в дрожжах (W.W. and X.C., неопубликовано).

Развивающие роли HEN3

РНК и белок HEN3 (HEN3-GUS) присутствуют в пролиферирующих ткань, где клетки должны координировать процессы развития, такие как клетки разделение, расширение и определение судьбы. HEN3, кажется, требуется для размножения клеток в листьях и определения судьбы клеток в меристемах цветков. Хотя прямая роль HEN3 в делении клеток не очевидна из фенотипы мутанта hen3, его гомолог CDK8 млекопитающих контролирует клетку пролиферация за счет отрицательной регуляции транскрипционной активности TFIIH (Акулитчев и др., 2000). Мы предполагают, что HEN3 может быть потенциальным связующим звеном между делением клеток и спецификация клеточной судьбы в цветочной меристеме. Например, ключевые регуляторы клеточное деление и спецификация клеточной судьбы могут скоординированно регулироваться HEN3 посредством регуляции транскрипции или фосфорилирования, таким образом связывая контроль клеточного деления со спецификацией клеточной судьбы. В качестве альтернативы, Активность HEN3 может регулироваться клеточным циклом, который гарантирует, что функция HEN3 в спецификации клеточной судьбы интегрирована с деление клеток.Хотя HEN3 RNA или HEN3-GUS не накапливаются в зависимым от клеточного цикла образом, активность HEN3 может регулироваться клеточным циклом через его партнерские циклины.

Как HEN3 может участвовать в размножении клеток? Размножение растительных клеток может зависеть от многих процессов, таких как релаксация клеточной стенки или реорганизация, эндоредупликация, ремоделирование цитоскелета и гормон сигнализация (обзор Clouse and Sasse, 1998; Косгроув, 1993; Сугимото-Сирасу и Робертс, 2003; Пустоши и Голуэй, 2003 г.).HEN3 может прямо или косвенно влиять на экспрессия или функция генов в любом из этих процессов.

Как HEN3 действует в пути AG, в настоящее время неизвестно. Наш предыдущая работа показала, что HUA1, HUA2, HEN2 и HEN4 предотвращают терминация транскрипции во втором интроне АГ. Мутации в этих генах приводит к снижению количества мРНК AG и увеличению обилие AG РНК1 и РНК2, транскриптов, которые заканчиваются на второй интрон. HEN3 способен фосфорилировать CTD, который регулирует удлинение транскрипции и координирует процессинг РНК с транскрипцией удлинение.Следовательно, вероятно, что HEN3 также участвует в производство альтернативных транскриптов от AG. Тем не менее Мутация hen3-1 приводит к увеличению накопления не только AG РНК1 и РНК2, но также и мРНК AG. Это может быть лучше объясняется ролью HEN3 в репрессии транскрипции, как это было продемонстрировано для белков CDK8 млекопитающих и дрожжей. Одно возможное объяснение для утраты фенотипов C-функции, вызванной мутациями hen3, что мутации hen3 приводят к более высокому уровню РНК из класса A гены, чем от AG, так что функция A побеждает функцию C во время развитие цветов.С другой стороны, HEN3 может играть косвенную роль в органе. идентичность благодаря своей основной функции в клеточном делении или удлинении клеток. Это возможно, что недостающие клетки или изменение времени удлинения клеток в зачатки органов могут влиять на их идентичность. Однако мы не наблюдали существенные различия в развитии зачатков органов между диким типом и мутанты hen3. Наконец, HEN3 может регулировать класс A или C белки фосфорилированием. Недавнее исследование показало, что зародышевые дрожжи Киназа cdc28, ключевой регулятор клеточного цикла, фосфорилирует не только белки. которые управляют событиями клеточного цикла, а также другими регуляторными белками, предположительно управлять глобальной экспрессией генов на протяжении клеточного цикла (Уберсакс и др., 2003). Другое исследование продемонстрировало, что Srb10, гомолог CDK8 у почкующихся дрожжей, регулирует рост нитчатых дрожжей в ответ на условия питания с помощью фосфорилирующий и, таким образом, регулирующий Ste12, необходимый фактор транскрипции для нитчатого роста (Nelson et al., 2003 г.). Возможно, что HEN3 действует как ген класса C за счет фосфорилирование белков класса C или класса A.

Благодарности

Мы благодарим докторов Бенедикте Десвойес и Кришанто Гутьеррес за кукурузный RBR плазмиду, д-ру Guozheng Liu за предложения по анализу протеинкиназы и Дунсюань Цзя за помощь во время клонирования HEN3 на основе карты.Мы поблагодарить Рэнди Керстеттера, Яэль Харрар и Джунджи Ли за полезные комментарии к рукопись. Эта работа была поддержана грантом NIH (GM61146) X.C.

Каталожные номера

  1. Акуличев С., Чуйков С., Рейнберг Д. (2000). TFIIH негативно регулируется cdk8-содержащим медиатором комплексы. Природа 407,102 -106.

  2. Барроко, Р. М., де Вейлдер, Л., Мадьяр, З., Энглер, Г., Инзе, Д. и Миронов В.(2003). Новые комплексы циклинзависимых киназы и циклиноподобный белок из Arabidopsis thaliana с функция не связана с делением клеток. Клетка. Мол. Жизнь Sci. 60 401 -412.

  3. Бониотти, М. Б. и Гутьеррес, К. (2001). А регулируемая клеточным циклом активность киназы фосфорилирует ретинобластому растений белок и содержит в Arabidopsis комплекс CDKA / циклин D. Завод J. 28,341 -350.

  4. Боуман, Дж.Л., Смит Д. Р. и Мейеровиц Э. М. (1989). Гены, управляющие развитием цветка у Arabidopsis.Plant Cell 1,37 -52.

  5. Чен, X. (2004). МикроРНК как трансляционный репрессор APETALA2 в развитии цветка арабидопсиса. Наука 303,2022 -2025.

  6. Чен, X. и Мейеровиц, Э. М. (1999). HUA1 и HUA2 - два члена цветочного гомеотика. АГАМНЫЙ путь. Мол. Клетка 3, 349-360.

  7. Чен, Х., Лю, Дж., Ченг, Ю. и Цзя, Д. (2002). HEN1 действует плейотропно в Арабидопсис участвует в развитии и C функции цветка. Развитие 129,1085 -1094.

  8. Cheng, Y., Kato, N., Wang, W., Li, J. и Chen, X. (2003). Два РНК-связывающих белка, HEN4 и HUA1, действуют в процессинг пре-мРНК AGAMOUS в Arabidopsis thaliana. Ячейка 4,53 -66.

  9. Кларк, С. Э., Бегущий, М. П. и Мейеровиц, Э.М. (1993). CLAVATA1, регулятор меристемы и цветка развитие у арабидопсиса. Разработка 119 397 -418.

  10. Клауз, С. Д. и Сассе, Дж. М. (1998). Брассиностероиды: важные регуляторы роста и развития растений. Анну. Rev. Plant Physiol. Завод Мол. Биол. 49 427 -451.

  11. Кокрофт, К. Э., ден Бур, Б. Г., Хили, Дж. М. и Мюррей, Дж. А. (2000). Циклин D - контроль скорости роста растений.Природа 405,575 -579.

  12. Коэн, Э. С. и Мейеровиц, Э. М. (1991). В война завитков: генетические взаимодействия, контролирующие развитие цветов. Природа 353,31 -37.

  13. Косгроув, Д. Дж. (1993). Расширяемость стены: это природа, измерение и связь с ростом растительных клеток. Новый Фитол. 124,1 -23.

  14. де Фалько, Г. и Джордано, А. (2002). CDK9: от базовой транскрипции до рака и СПИДа.Cancer Biol. Ther. 1,342 -347.

  15. de Veylder, L., Beeckman, T., Beemster, G. T., de Almeida Энглер, Дж., Орменезе, С., Маес, С., Наудтс, М., ван дер Шуерен, Э., Jacqmard, A., Engler, G. et al. (2002). Контроль над пролиферация, эндоредупликация и дифференциация Фактор транскрипции Arabidopsis E2Fa-DPa. EMBO J. 21,1360 -8.

  16. Девитт, В. и Мюррей, Дж. А. (2003). Завод клеточный цикл.Анну. Rev. Plant Biol. 54 235 -264.

  17. Дитрих, М.А., Пренгер, Дж. П. и Гилфойл, Т. Дж. (1990). Анализ генов, кодирующих наибольшую субъединицу РНК полимераза II арабидопсиса и сои. Завод Мол. Биол. 15 207 -223.

  18. Густафсон-Браун, К., Сэвидж, Б. и Янофски, М.Ф. (1994). Регулирование цветочного гомеотика Arabidopsis ген APETALA1. Ячейка 76 131 -143.

  19. Гайдукевич, П., Сваб З., Малига П. (1994). Небольшое универсальное семейство pPZP Бинарные векторы Agrobacterium для трансформации растений. Завод Мол. Биол. 25 989 -994.

  20. Харбор, Дж. У. и Дин, Д. К. (2000). Руб. функция регуляции клеточного цикла и апоптоза. Nat. Клетка Биол. 2, E65 -E67.

  21. Хемерли, А., Энглер Джде, А., Бергуниу, К., ван Монтегю, М., Энглер Г., Инзе Д. и Феррейра П. (1995). Доминирующий отрицательные мутанты киназы Cdc2 отключают деление клеток от итеративного развитие растений.EMBO J. 14,3925 -3936.

  22. Хантли, Р., Хили, С., Фриман, Д., Лаванда, П., де Ягер, С., Гринвуд, Дж., Маккер, Дж., Уокер, Э., Джекман, М., Се, Q. et al. (1998). Гомолог белка ретинобластомы кукурузы ZmRb-1 является регулируется во время развития листа и демонстрирует консервативные взаимодействия с Регуляторы G1 / S и белки циклина D (CycD) растений. Завод Мол. Биол. 37 155 -169.

  23. Джуб, Дж., Шевалье, К., Дудиц, Д., Хеберле-Борс, Э., Инзе, Д., Умеда М. и Ренауди Дж. П. (2000). CDK-родственный белок киназы в растениях. Завод Мол. Биол. 43 607 -620.

  24. Кобор, М.С. и Гринблатт, Дж. (2002). Регулирование удлинения транскрипции путем фосфорилирования. Биохим. Биофиз. Акта 1577 261 -275.

  25. Ло, Т., Майер, К. Ф., Бергер, Дж. И Юргенс, Г. (1996). Ген WUSCHEL необходим для побегов и целостность цветочной меристемы Arabidopsis.Разработка 122, 87-96.

  26. Lenhard, M., Bohnert, A., Jurgens, G. и Laux, T. (2001). Прекращение поддержки стволовых клеток в Цветочные меристемы Arabidopsis при взаимодействии между WUSCHEL и АГАМУС. Ячейка 105 805 -814.

  27. Ли, Дж. И Чен, X. (2003). ПРИОСТАНОВЛЕН, предполагаемый exportin-t, действует плейотропно в развитии Arabidopsis, но является необязательны для жизнеспособности. Plant Physiol. 132,1913 -1924.

  28. Ли, Дж., Цзя, Д. и Чен, X. (2001). HUA1, регулятор идентичности тычинок и плодолиц в Arabidopsis, кодирует ядерный белок, связывающий РНК. Растительная клетка 13,2269 -2281.

  29. Ляо, С. М., Чжан, Дж., Джеффри, Д. А., Колеске, А. Дж., Томпсон, К. М., Чао, Д. М., Вилджоэн, М., ван Вуурен, Х. Дж. И Янг, Р. А. (1995). Пара киназа-циклин в РНК-полимеразе II холоэнзим. Природа 374 193 -196.

  30. Ломанн, Дж. У., Хонг, Р. Л., Хобе, М., Буш, М. А., Парси, Ф., Саймон Р. и Вейгель Д. (2001). Молекулярная связь между регуляция стволовых клеток и формирование цветочного паттерна у Arabidopsis.Cell 105,793 -803.

  31. Magyar, Z., Meszaros, T., Miskolczi, P., Deak, M., Feher, A., Браун С., Кондороси Э., Афанасиадис А., Понгор С., Билгин М. и др. (1997). Специфичность фазы клеточного цикла предполагаемых циклинзависимых варианты киназ в синхронизированных клетках люцерны.Растение Ячейка 9,223 -235.

  32. Мандель, М.А., Густафсон-Браун, К., Сэвидж, Б. и Янофски, М. Ф. (1992). Молекулярная характеристика Цветочный гомеотический ген Arabidopsis APETALA1.Nature 360 ​​273 -277.

  33. Мариконти, Л., Пеллегрини, Б., Кантони, Р., Стивенс, Р., Бергуниу К., Селла Р. и Албани Д. (2002). E2F семейство факторов транскрипции Arabidopsis thaliana. Роман и консервативные компоненты пути ретинобластома / E2F у растений.J. Biol. Chem. 277,9911 -9919.

  34. Майер, К. Ф., Шуф, Х., Хеккер, А., Ленхард, М., Юргенс, Г. и Laux, T. (1998). Роль WUSCHEL в регулировании судьба стволовых клеток в меристеме побегов Arabidopsis. Ячейка 95 805 -815.

  35. Мейер, М. и Мюррей, Дж. А. Х. (2000). В роль и регуляция циклинов D-типа в клеточном цикле растений. Завод Мол. Биол. 43 621 -633.

  36. Мейеровиц, Э.М., Боуман, Дж. Л., Брокман, Л. Л., Дрюс, Г. Н., Джек Т., Зиберт Л. Э. и Вейгель Д. (1991). Генетический и молекулярная модель развития цветков Arabidopsis thaliana. Приложение 157. -167.

  37. Морган Д. О. (1997). Циклинзависимые киназы: двигатели, часы и микропроцессоры. Анну. Rev. Cell Dev. Биол. 13 261 -91.

  38. Накагами, Х., Секине, М., Мураками, Х. и Синмё, А. (1999).Белок, связанный с ретинобластомой табака, фосфорилируемый отдельный циклин-зависимый киназный комплекс с Cdc2 / циклин D in vitro. Завод J. 18 243 -252.

  39. Нельсон К., Гото С., Лунд К., Хунг В. и Садовски И. (2003). Srb10 / Cdk8 регулирует рост нитчатых дрожжей с помощью фосфорилирование фактора транскрипции Ste12. Природа 421 187 -190.

  40. Oelgeschlager, T. (2002). Регулирование РНК активность полимеразы II за счет фосфорилирования CTD и контроля клеточного цикла.J. Cell Physiol. 190 160 -169.

  41. Пак В., Ли Дж., Сонг Р., Мессинг Дж. И Чен X. (2002). CARPEL FACTORY, гомолог Dicer, и HEN1, роман белок, участвуют в метаболизме микроРНК у Arabidopsis thaliana. Curr. Биол. 12 1484 -1495.

  42. Пелаз, С., Дитта, Г.С., Бауман, Э., Висман, Э. и Янофски, М. Ф. (2000). Функции идентичности цветочных органов B и C требуют SEPALLATA MADS-box гены. Природа 405 200 -203.

  43. Порседду, А., Сталс, Х., Райхельд, Дж. П., Сегерс, Г., де Вейлдер, Л., Барроко, Р. П., Кастилс, П., ван Монтегю, М., Инз, Д. и Миронов, В. (2001). Специфическая для растений циклин-зависимая киназа участвует в контроле развития G2 / M у растений. J. Biol. Chem. 276,36354 -36360.

  44. Рикерт, П., Сегеззи, В., Шанахан, Ф., Чо, Х. и Лиз, Э. (1996). Циклин C / CDK8 представляет собой новую киназу, ассоциированную с CTD. с РНК-полимеразой II.Онкоген 12,2631 -2640.

  45. Riou-Khamlichi, C., Huntley, R., Jacqmard, A. и Murray, J. А. (1999). Активация цитокининов клетки арабидопсиса деление через циклин D-типа. Наука 283,1541 -1544.

  46. Шуф, Х., Ленхард, М., Хеккер, А., Майер, К. Ф., Юргенс, Г. и Лаукс, Т. (2000). Стволовая клетка Популяция меристем побегов арабидопсиса поддерживается регуляторная петля между генами CLAVATA и WUSCHEL.Ячейка 100 635 -644.

  47. Сугимото-Ширасу К. и Робертс К. (2003). Big it up »: эндоредупликация и контроль размера клеток у растений. Curr. Opin. Plant Biol. 6, 544-553.

  48. Sun, X., Zhang, Y., Cho, H., Rickert, P., Lees, E., Lane, W. и Рейнберг, Д. (1998). NAT, человеческий комплекс, содержащий Srb полипептиды, которые действуют как негативный регулятор активированных транскрипция. Мол. Клетка 2, 213-222.

  49. Такеда К., Сайто Т. и Очиаи Х. (2002). А новый Dictyostelium Cdk8 требуется для агрегации, но он незаменим для роста. Развивать. Разница в росте. 44 213 -223.

  50. Уберсакс, Дж. А., Вудбери, Э. Л., Куанг, П. Н., Параз, М., Блетроу, Дж. Д., Шах, К., Шокат, К. М., Морган, Д. О. (2003). Мишени циклин-зависимой киназы Cdk1. Природа 425,859 -864.

  51. Вандепоэле, К., Raes, J., de Veylder, L., Rouze, P., Rombauts, С. и Инзе Д. (2002). Полногеномный анализ основной клетки гены цикла у Arabidopsis. Растительная клетка 14 903 -916.

  52. Вэйстни, Г. О. и Голуэй, М. Э. (2003). Ремоделирование цитоскелета для роста и формы: обзор с некоторыми новыми взгляды. Анну. Rev. Plant Biol. 54 691 -722.

  53. Western, T. L., Cheng, Y., Jun, L. и Chen, X. (2002). HUA ENHANCER2, предполагаемая DExH-бокс-РНК-геликаза, поддерживает гомеотическую экспрессию генов B и C у Arabidopsis.Развитие 129,1569 -1581.

  54. Се, К., Санс-Бургос, А. П., Ханнон, Г. Дж. И Гутьеррес, К. (1996). Клетки растений содержат новый член ретинобластомы семейство белков, регулирующих рост. EMBO J. 15,4900 -4908.

  55. Ямагути, М., Фабиан, Т., Заутер, М., Бхалерао, Р. П., Шредер, Дж., Сандберг, Г., Умеда, М. и Учимия, Х. (2000). Активация киназы, активирующей CDK, зависит от взаимодействие с циклинами H-типа в растениях.Завод Дж. 24, 11-20.

  56. Янофски, М. Ф., Ма, Х., Боуман, Дж. Л., Дрюс, Г. Н., Фельдманн, К. А. и Мейеровиц, Э. М. (1990). Белок, кодируемый гомеотический ген Arabidopsis AGAMOUS напоминает факторы транскрипции. Природа 346, 35-39.

То же самое, но другое: вариация кластерной архитектуры в пяти линиях клональной селекции «Пино Нуар» коррелирует с дифференциальной экспрессией трех факторов транскрипции и других генов, связанных с ростом) является экономически важной культурой, которая должна соответствовать высоким стандартам качества для производства фруктов, соков и вина. Требуется интенсивная защита растений, чтобы избежать потерь, вызванных грибковыми инфекциями. Сорта виноградной лозы с рыхлой структурой гроздей позволяют снизить количество защитных химических обработок благодаря их повышенной устойчивости к грибковым инфекциям, таким как серая гниль, вызванная Botrytis cinerea. Недавнее исследование идентифицировало ген фактора транскрипции VvGRF4 как детерминант структуры соцветий в образцах рыхлых и компактных квазиизогенных клонов «Пино Нуар».Здесь мы расширили анализ до 12 клонов «Пино Нуар», сгруппированных по-разному, полученных в результате пяти различных программ клональной селекции. Дифференциальная экспрессия генов этих клонов изучалась в трех разных местах в течение трех сезонов на демонстрационных виноградниках. Два фенотипически контрастирующих клона выращивали во всех трех местах и ​​служили для стандартизации последующих анализов. Данные о дифференциальной экспрессии генов коррелировали с фенотипической изменчивостью суб-признаков кластерной архитектуры.Последовательная дифференциальная экспрессия гена VvGRF4 по отношению к свободным кластерам была проверена в различных средах и в расширенном наборе клонов «Пино Нуар». Кроме того, были идентифицированы еще 14 генов со стойкими различиями экспрессии между свободно и компактно сгруппированными клонами независимо от сезона и местоположения. Эти гены имеют аннотации, относящиеся к клеточному росту, удлинению клеточной стенки, делению клеток и метаболизму ауксина. В их состав входят еще два гена факторов транскрипции.

Введение

Виноградная лоза (Vitis vinifera L.) - одна из важнейших плодовых культур в мировом масштабе. Мировое производство винограда в 2016 году достигло 75,8 млн тонн (OIV 2017a). Стоимость мирового валового производства винограда составила более 67,5 миллиардов долларов США (FAOSTAT, 2016). Независимо от использования в качестве вина виноград, столовый виноград или сухофрукты (изюм) для сбыта приемлемы только фрукты высокого качества. К сожалению, сорта винограда V. vinifera восприимчивы к нескольким патогенам, и виноградарство требует интенсивного применения средств защиты растений (СЗР) для удовлетворения требований рынка.Фунгициды неизбежны для борьбы с патогенами (Pertot et al., 2017), вызывающими мучнистую росу, Erysiphe necator (син. Uncinula necator, (Schw.) Burr), ложную мучнистую росу, Plasmopara viticola (Berk. & Curt) Berl. & de Toni) и Botrytis cinerea (телеоморф Botryotinia fuckeliana ((de Bary) Whetzel), провоцирующие серую гниль. Использование PPP, независимо от их неорганического (медь и сера) или синтетического происхождения, способствует уменьшению биоразнообразия и увеличивает количество потребителей проблемы (Keulemans et al.2019). Одной из стратегий сокращения их использования является выращивание устойчивых к патогенам сортов винограда, например путем интрогрессии генетически захваченных локусов устойчивости против Erysiphe necator и Plasmopara viticola из диких Vitis spec. родственников в качественные сорта Vitis vinifera. В последние годы появилось несколько улучшенных сортов с признаками устойчивости к мучнистой росе. Однако в отношении Botrytis cinerea имеются только предварительные сведения о предполагаемом локусе устойчивости (Sapkota et al.2019). Таким образом, текущее развитие сорта сосредоточено на обеспечении физических барьеров, например толстая кожица ягод, гидрофобная поверхность ягод и рыхлая структура кластеров для повышения устойчивости к B. cinerea (Габлер и др., 2003; Герцог и др., 2015; Шавруков и др., 2004). В рыхлой грозди винограда улучшенная вентиляция ускоряет высыхание после дождя или утренней росы. Пониженная влажность снижает количество инфекций, вызываемых грибковыми патогенами (Hed et al. 2009; Molitor et al. 2012). Кроме того, фунгицидные спреи могут лучше распределяться в рыхлую гроздь по сравнению с компактной (Hed et al.2010). Высокая физическая нагрузка, возникающая между ягодами компактных гроздей при созревании, вызывает микротрещины или даже разрыв кожуры ягод (Becker and Knoche 2012; Smart and Robinson 1991). Этой проблемы можно избежать при использовании слабо сгруппированных пучков. Кроме того, внутри слабо структурированных кластеров менее выражены температурные градиенты, поскольку солнечное излучение лучше проникает внутрь ягод. Это обеспечивает более равномерную зрелость плодов (Pieri et al., 2016; Vail and Marois, 1991). В целом, рыхлая кластерная архитектура приводит к тому, что виноград меньше заражается Botrytis cinerea и лучше согласован процесс созревания.Это очень желанная черта в селекции винограда. Понимание его генетической основы должно помочь в разработке новых инструментов для эффективного разведения винограда и клональной селекции.

Во всем мире существует несколько тысяч сортов винограда. Они зарегистрированы в хранилищах данных, например «Международный каталог сортов Vitis» (http://www.vivc.de) (Maul 2019). Генофонд винного и столового винограда демонстрирует заметные различия в архитектуре ягод и гроздей (Di Genova et al., 2014; Migicovsky et al.2017). Несмотря на это впечатляющее генетическое разнообразие, только 33 сорта (Vitis vinifera L. subsp. Vinifera) составляют 50% всех площадей, используемых для коммерческого производства (OIV 2017). Внутри этих преобладающих сортов внутрисортовая генетическая изменчивость, вызванная соматической мутацией (De Lorenzis et al., 2017), может использоваться для отбора клональных вариантов желаемого фенотипа кластерной архитектуры.

Архитектура связки контролируется экологическими и генетическими факторами (Деринг и др., 2015; Телло и Ибаньес, 2017).Это сложный признак, определяемый взаимодействием характеристик ягод и стеблей (Ли и др., 2019; Рихтер и др., 2018; Рист и др., 2018). Некоторые из этих подтипов находятся под генетическим контролем, как сообщается в отношении размера ягоды, объема ягоды и веса ягод (Ban et al., 2016; Houel et al. 2015; Mejia et al. 2007; Tello et al. 2015), количества ягод ( Dry et al. 2010; Fanizza et al. 2005) и другие суб-черты рахиса (Correa et al. 2014; Marguerit et al. 2009; Tello et al. 2016).

Внутрисортовое разнообразие суб-черт кластерной архитектуры сортов винограда было зарегистрировано лишь в нескольких случаях, таких как «Гарнача Тинта», «Темпранильо», «Альянико» и «Мускат Александрийский» (Grimplet et al.2019; Grimplet et al. 2017). Для клонов «Альбариньо» и для клонов «Пино Нуар» исследования Alonso-Villaverde et al. (2008) и Конрад и др. (2003) доказали, что вариативность внутрисортовой кластерной архитектуры коррелирует с восприимчивостью к B.cinerea, то есть слабо кластерные клоны демонстрируют пониженную восприимчивость. В «Пино Нуар» (PN) ген VvGRF4 был недавно обнаружен как главный компонент, влияющий на архитектуру соцветий (Россманн и др., 2019). PN является членом очень старого семейства «Пино» (Regner et al.2000) и веками используется в виноградарстве. В настоящее время на площади 115 000 га PN входит в число тринадцати лучших международных сортов (OIV 2017). Семейство «Пино» накопило большое количество соматических мутаций и дало начало широкому спектру клонов, проявляющих различные фенотипические особенности, например разный цвет ягод, разный органолептический вид, разная сила и структура гроздей (Forneck et al. 2009). Что касается кластерной архитектуры (CA), клоны были разделены на три категории: i.е. компактные (CCC), рассыпные (LCC) и смешанные (MBC) ягоды «Пино Нуар» клоны (Bleyer 2001; Ruehl et al. 2004).

В предыдущем исследовании два слабо сгруппированных клона PN из селекционной линии «Мариафельд» (M171) и программы клональной селекции Гейзенхайма (Gm1-86) сравнивали с двумя компактно сгруппированными клонами («Frank Charisma» и «Frank Classic» ). Это исследование выявило мутацию в сайте связывания микроРНК mi396 VvGRF4, гена, кодирующего фактор транскрипции, способствующий росту.Мутация предотвращает подавление транскрипта VvGRF4, в частности, в клонах LCC. Были идентифицированы два мутировавших аллеля: один специфичен для M171, а другой обнаружен в Gm1-86. Оба работают в гетерозиготном состоянии, приводят к увеличению количества клеток в ножках в рыхлых кластерах и, таким образом, вносят вклад в свободную кластерную архитектуру (Rossmann et al. 2019). В этом исследовании изучались вариации кластерной архитектуры в сочетании с дифференциальной транскрипционной активностью в расширенном наборе из двенадцати клонов PN из разных линий отбора.Помимо других генов, активность VvGRF4 была исследована, чтобы проверить его актуальность в других клонах PN и в нескольких средах.

Подробная морфологическая характеристика была предпринята заранее, чтобы выявить соответствующие суб-черты кластерной архитектуры в пределах клональных групп PN. Эти суб-признаки были проиндексированы, чтобы сгруппировать клоны в рыхлые и компактные клоны. Уровни экспрессии генов, выбранных из предыдущего исследования RNA-Seq, включая VvGRF4 (Rossmann et al. 2019), или литературных ссылок были затем опрошены, чтобы идентифицировать дифференциально экспрессируемые гены, участвующие в экспрессии компактности пучка.При расширении предыдущей работы были учтены экологические эффекты. Растения PN из трех географически разных пробных площадей, управляемые с использованием органических и интегрированных методов, исследовались в течение трех последовательных вегетационных сезонов. В дополнение к VvGRF4 это исследование выявило дополнительные гены, участвующие в определении архитектуры кластера, действующие независимо от факторов окружающей среды (сезон, местоположение, управление виноградниками) в расширенном и разнообразном клональном наборе PN. Эти недавно идентифицированные гены кодируют еще два фактора транскрипции и функции, связанные с метаболизмом ауксина и клеточным ростом.

Материалы и методы

Растительный материал

Сорт Vitis vinifera «Пино Нуар» был исследован на 12 клонах, демонстрирующих дивергентную кластерную архитектуру. Они включали компактно сгруппированные клоны (CCC), слабо сгруппированные клоны (LCC) и клоны, несущие ягоды разного размера (MBC). Растения были распределены по трем плантациям в трех областях виноградарства Германии (Пфальц, Баден и Гессен) с частичным дублированием (таблица 1). Виноградники в Бадене и Гессене управлялись виноградниками и происходили из сертифицированного материала.Они подвергались регулярному визуальному контролю за их фитосанитарным состоянием. Клоны PN были хорошо прижились (лозы возрастом около 20 лет), и все они были привиты на один и тот же подвой (Kober 125AA). Повсюду применялась «обрезка по гайоту» и использовалась решетчатая система с вертикальным расположением побегов от 1,8 до 2,2 м 2 пространства на одну лозу. Виноградники в Бадене и Гессене обслуживались с интегрированным управлением. Опытное поле в Пфальце принадлежит Институту разведения виноградных лоз Geilweilerhof им. Юлиуса Куэна.Это управлялось в соответствии с правилами органического земледелия (Döring et al. 2015) (Интернет-ресурс 1). Все плантации содержали достаточно материала отдельных растений PN, что позволяло случайный отбор образцов от отдельных клонов. Образцы были взяты исключительно с растений без каких-либо симптомов инфекции или отклонений от типичного клонального типа внешнего вида.

Таблица 1.

Графики отбора проб для 12 клонов «Пино Нуар» в трех местах в течение трех сезонов. Для фенотипирования кластерных признаков были взяты образцы спелых гроздей на BBCH89 с 10 повторами от случайно выбранных независимых лоз.Измерения клонов PN «Frank Charisma» (FkCH) и «Gm20-13», присутствующих во всех трех местах, позволили смоделировать влияние окружающей среды на под-черты кластерной архитектуры (Интернет-ресурс 3 a и b).

Выборка

Для фенотипической оценки на BBCH89 (ягоды, созревшие для сбора урожая), случайным образом были выбраны десять лоз на клон. С каждой лозы в 2015 и 2016 годах на каждом винограднике была собрана нижняя гроздь центрального побега плодового тростника. Пучки нарезали непосредственно на стыке с побегом и хранили при 5 ° C до использования.Образцы для экспериментов по экспрессии генов были взяты таким же образом (таблица 2), но собраны в трех экземплярах на ранних стадиях развития BBCH57 (непосредственно перед цветением) и BBCH71 (в период раннего завязывания плодов) в течение трех лет с 2015 по 2017 год. Полные соцветия. были разрезаны и немедленно заморожены в жидком азоте. Модель, основанная на нелинейной кумулятивной градусо-днях (CDD) (Молитор и др., 2014), скорректировала выборку, чтобы обеспечить одинаковую стадию развития в трех исследуемых местах в течение всех трех лет.Сумма заданных температур составляла 400 ° CDD для BBCH57 и 700 ° CDD для BBCH71. Расчет CDD был основан на температурах воздуха на высоте 2 м, зафиксированных ближайшей метеостанцией. Подробный график отбора проб и записи температуры представлен на онлайн-ресурсе 2.

Таблица 2.

График отбора проб для дифференциального анализа экспрессии генов

Оценка вегетативного роста

Жизнеспособность клонов PN оценивалась путем измерения массы однолетний прирост i.е. вес десяти наиболее базально расположенных ветвей на десяти лозах за сезон и местоположение (Интернет-ресурс 1, таблица 3).

Таблица 3.

Морфометрические измерения кластерной архитектуры для 12 клонов «Пино Нуар» на BBCH89, записанные в трех местах и ​​двух сезонах. Расчетные (маргинальные) средние суб-признаков и индексов компактности для каждого клона, скорректированные с учетом эффектов «местоположения» и «сезона», как предсказано на основе обобщенной линейной модели «суб-признак» ∼ loc * год + клон (подробности см. На Интернет-ресурсе 2).(±) представляет собой стандартную ошибку. Разные буквы указывают на значительно отличающиеся значения суб-признаков и индексов компактности, как это было идентифицировано с помощью теста Tukey HSD при уровне значимости α = 0,05.

Фенотипическая оценка суб-признаков кластерной архитектуры

Измерения 12 суб-признаков кластерной архитектуры (таблица 3) оценили фенотипы. Рассчитаны три показателя компактности кластера. Отношение «количество ягод / длина рахиса» (BN / RL [см], Hed et al., 2009) и индексы CI-12 (вес ягоды [г] / (длина рахиса [см]) 2 и CI- 18 (вес ягоды [г] x количество ягод / (длина плодоножки [см] + ​​длина рахиса [см]) 2 x длина рахиса [см] x длина цветоножки [мм]) по предложению Телло и Ибанеса (2014) .

Экстракция РНК и синтез кДНК

Предцветущие цветы (BBCH57), соответственно ягоды завязывания плодов (BBCH71), были осторожно удалены из образцов. Полностью оставшуюся структуру рахиса измельчали ​​в мелкий порошок. Все этапы выполнялись в жидком азоте. Аликвоты образца ткани смешивали с 500 мг поливинилпирролидона Polyclar® AT (Serva Electrophoresis GmbH, Гейдельберг, Германия). Для экстракции тотальной РНК использовали набор Spectrum ™ Plant Total RNA Kit (Sigma Aldrich, Дармштадт, Германия), следуя протоколу «А».Расщепление ДНКазой на колонке ДНКазой, не содержащей РНКаз (QIAGEN, Hilden, Германия), проводили в соответствии с протоколом производителя. Целостность и количество РНК анализировали с помощью спектрофотометрии (Clario Star 0430, BMG Labtech, Ортенберг, Германия) и проверки 500 нг общей РНК с помощью неденатурирующего электрофореза в агарозном геле (1%). 250 нг общей РНК использовали для синтеза первой цепи кДНК с помощью набора для транскрипции кДНК высокой емкости (Applied Biosystems, ThermoFisher Scientific, Уолтем, Массачусетс, США) в соответствии с протоколом производителя.

Дизайн праймеров

Праймеры (перечисленные в онлайн-ресурсе 3) были разработаны в соответствии с рекомендациями (Citri et al.2012) с использованием программного обеспечения для разработки праймеров CLC-main workbench (CLC Main Workbench Version 8.0.1, QIAGEN www.qiagenbioinformatics. com). Стандартные RT-qPCR выполняли с использованием PowerSYBR-Green PCR Master Mix (Applied Biosystems). Специфичность ампликонов оценивали визуальным осмотром кривых амплификации и плавления RT-qPCR и гель-электрофорезом продуктов PCR (после 40 термических циклов с контролем размера на 3% агарозе).Эффективность ПЦР-амплификации пар праймеров для 91 гена-мишени и двух эндогенных контрольных генов была подтверждена, как предложено на этапах 14 и 15 протокола Schmittgen and Livak (2008).

Экспресс-анализ с использованием высокопроизводительной количественной ПЦР в реальном времени

Для экспрессионного анализа использовалась высокопроизводительная система BioMark ™ HD (Fluidigm Corporation, Мюнхен, Германия) с чипами динамического массива (96.96 GE IFC; Fluidigm) в соответствии с инструкциями производителя. Для регистрации и обработки данных люминесценции использовалось программное обеспечение BioMark Real-Time PCR Analysis Software 3.0,2 (Fluidigm). Общая оценка качества эксперимента составила 0,945. Вариация между чипами была низкой (от 0,92 до 0,97). Значения C t нескольких микросхем 96,96 IFC были объединены с их метаданными в набор выражений с использованием R-пакета «HT-q-PCR» (Dvinge and Bertone 2009). Все значения C t ниже 5 и значения C t генов, показывающие небольшие различия между выборками (с межквартильным диапазоном ниже 0,6), были отброшены.

Относительное количество молекул мРНК рассчитывали на основе значения C t (номер цикла на пороге).Порог цикла был определен с автоматической установкой линейной базовой линии.

Нормализация

Гены VIT_17s0000g10430, кодирующие глицеральдегид-3-фосфатдегидрогеназу (GAPDH), и VIT_08s0040g00040, кодирующие убиквитин-конъюгированный фермент E2 (UBIc; Интернет-ресурс 3), служили в качестве ссылок. Эти гены уже успешно применялись в других исследованиях ОТ-КПЦР, например. (Монтейро и др., 2013; Рид и др., 2006; Селим и др., 2012; Упадхьяй и др., 2015). Их экспрессия оказалась инвариантной по рангу в ткани позвоночного столба по клонам, местоположению и сезонам выращивания (как показано с помощью функции «normalizectdata» пакета «HT-qPCR»).Для получения значения ΔC t значение C t каждого целевого гена нормализовали путем вычитания средних значений C t из двух эндогенных контрольных генов (GAPDH, UBIc). Для сравнения экспрессии генов между клонами, сезонами и местоположениями виноградников было вычислено значение 2 - ΔΔCt (Livak and Schmittgen 2001). Относительную экспрессию (2 -ΔCt ) клона «Пино нуар» Gm20-13 в каждом отдельном месте и сезоне вычитали из (2 -ΔCt ) любого другого исследованного клона PN для стандартизации.

Статистика

Для всей статистики использовалось программное обеспечение R версии 3.5.3 (R Core Team 2013).

Архитектура кластера. Воздействие окружающей среды на каждый суб-признак кластерной архитектуры оценивалось с использованием обобщенных линейных моделей (GLM) с клоном, местоположением, сезоном и двусторонним взаимодействием между местоположением и сезоном в качестве независимых переменных. Для данных подсчета использовали GLM с распределением Пуассона или (в случае избыточной дисперсии) с отрицательным биномиальным распределением. Для строго положительных непрерывных ответов применялась гамма-модель GLM с логарифмической связью или линейная модель.Остатки модели оценивались визуально, и при необходимости проверялась дисперсия. Эффекты были протестированы с использованием дисперсионного анализа третьего типа и функции «Anova» пакета «автомобиль» (Fox and Weisberg 2011) и визуализированы с помощью функции «все эффекты» пакета «эффекты» (Интернет-ресурс 4). Расчетные предельные средние, тесты posthoc и попарные сравнения с компактным отображением букв были рассчитаны для влияния «клона» на ответ с учетом влияния «сезона» и «местоположения» (таблица 3) с использованием функций «emmeans» и « CLD »пакета« emmeans »(Lenth 2019).Уровень значимости был установлен на 0,05.

Дифференциальная экспрессия генов, обозначенная как кратное изменение (FC), была рассчитана с использованием пакета «limma» (Matthew et al. 2015). Сначала с помощью функции «model.matrix» была сгенерирована матрица дизайна, содержащая экспериментальную информацию для всех клонов PN в трех испытательных точках и трех сезонах. Во-вторых, корреляция между техническими повторами оценивалась с помощью функции «duplicatecorrelation». Дифференциальная экспрессия генов была проанализирована путем подбора линейных моделей для генов с использованием матрицы дизайна, предполагаемой корреляции и функции «lmFit».Для интерпретации различных экспрессий генов использовался эмпирический метод Байеса, чтобы изменить стандартные ошибки в сторону общего значения с помощью функции «eBayes».

Контраст: логарифм (2) FC (-ΔΔC t ) для каждого гена был рассчитан по разнице экспрессии со стандартным клоном Gm20-13 (как определено в матрице контраста) с использованием функции «Contrasts.fit» »(Интернет-ресурс 5). Результаты относительной экспрессии генов отображались на тепловых картах как log 2 FC (-ΔΔC t ) с помощью пакета «pheatmap» (Kolde 2015).Данные в масштабе строк (по генам) и евклидово расстояние использовались для иерархической кластеризации на тепловых картах. Данные экспрессии тестируемых генов (log 2 FC), отображаемые в виде диаграмм-коробок-усов, были получены таким же образом, как указано выше, но с модельной матрицей, содержащей дополнительно биологическую репликацию (Интернет-ресурс 6).

Разделение дисперсии: для оценки вариации в этом эксперименте по многоуровневой экспрессии генов использовался пакет «variancePartition» с логарифмом 2 ΔC t .Линейная смешанная модель со случайными эффектами сезона, местоположения, партии, биологической репликации, типа кластера, клона и генофонда определила типичные факторы дисперсии. Это были экологические («сезон» и «местоположение»), технические (две повторяющиеся «партии»), биологические (три независимых «повтора»), фенотипические («кластерный тип») и генетические («клон» и «генофонд», т.е. фон отбора клонов ENTAV, Frank, Fr (Фрайбург), Gm (Гейзенхайм) и We (Вайнсберг)) (Hoffman and Schadt, 2016). Корреляция между относительной экспрессией тестового гена, выраженной как log (2) FC (-ΔC t ), и записями суб-признака кластерной архитектуры клонов «Пино Нуар» за 2015 и 2016 годы была рассчитана с помощью ранговой корреляции Спирмена с использованием функции «Rcorr» из пакета «Hmisc» (Harrell Jr 2015) (Таблица 4, Таблица 5, Интернет-ресурсы 7, 8).

Таблица 4.

Средний логарифм кратных изменений экспрессии гена (2) FC (-ΔΔC t ) на ранней стадии развития плода (BBCH71) в слабо сгруппированных клонах (LCC), смешанных ягодных клонах (MBC) и компактно сгруппированных клонах (CCC) по сравнению со стандартным клоном «Пино Нуар» Gm20-13

Таблица 5.

Коэффициент корреляции (r) между относительными изменениями экспрессии выбранных генов и ключевыми суб-признаками кластерной архитектуры и прироста древесины (сокращения см. Таблица 2).Экспрессию гена относительно (GAPDH) и UBIc (log (2) FC) измеряли непосредственно перед цветением (BBCH57) и сразу после цветения (BBCH71). Результаты для суб-черт кластерной архитектуры клонов «Пино Нуар» были зарегистрированы на стадии созревших гроздей BBCH89. Прирост древесины регистрировали после опадания листьев (BBCH97). Корреляция Спирмена (r) значима при * p <0,05, ** p <0,01, *** p <0,001 и **** p <0,0001. Положительная корреляция отмечена светло-красным цветом, отрицательная корреляция - голубым.

Результаты

Особенности кластерной архитектуры клонов «Пино Нуар»

Типичные различия в кластерной архитектуре (CA), проявляемые исследуемыми (PN) клонами на стадии BBCH89 (ягоды, созревшие для сбора урожая), показаны на рисунке 1.

Рисунок 1.

Клоны Vitis vinifera cv. «Пино Нуар» с другой кластерной архитектурой Фенологическая стадия BBCH89 (ягоды, созревшие для сбора урожая) использовалась для оценки кластерной архитектуры. (а) Компактные клоны с ягодами некруглой формы из-за высокого давления между ягодами.(b) Рыхлые клоны с заметно увеличенной длиной рахиса и цветоножки. (c) Клоны, несущие частично более мелкие ягоды, приводящие к снижению компактности (смешанные клоны с ягодами). Красные стрелки выделяют подчеркнутую особенность кластерной архитектуры. Стандарт размера - 1 см. Стадии развития согласно (Lorenz et al. 1995)

Морфологические характеристики спелых гроздей были оценены на 12 клонах PN, распределенных в трех географических точках в 2015 и 2016 годах на BBCH89 (таблица 1, онлайн-ресурс 1).Клоны PN Gm20-13 (MBC) и Frank Charisma (CCC) были представлены во всех трех местах. Они позволили оценить влияние местоположения и сезона на характеристики архитектуры кластера. Отношение «количество ягод / длина рахиса» и индексы CI-12 и CI-18 (Tello and Ibáñez, 2014) применялись для классификации клонов PN. Их общая визуальная классификация на рыхлые и компактные клоны (Ruehl et al. 2004) была подтверждена, и клоны были охарактеризованы как три CCC, два MBC и шесть LCC (Таблица 1, Таблица 2).Клон Gm18 остался неклассифицированным из-за нестабильной экспрессии суб-признаков, представленных в индексах.

Всего было оценено 12 подтипов кластерной архитектуры (CA). Десять из 12 суб-признаков значительно различались между клонами. Длина первого междоузлия (I1L) и второго междоузлия (I2L) не изменялась (таблица 3). Клон PN Gm20-13 постоянно демонстрировал низкие значения суб-признаков СА (мелкие ягоды, короткие стебли, т.е. MBV и RL, таблица 3). Факторы «сезон» и «местоположение» были оценены в клонах Gm20-13 и FkCH, которые были представлены во всех трех местоположениях (Гессен, Баден, Пфальц).«Сезон» повлиял на количество ягод (BN), средний объем ягод (MBV), общий объем ягод (TBV), длину рахиса (RL), длину плеча (SL) и вес рахиса (RW). Фактор «местоположение» повлиял на вес кластера подтипов (CW), средний объем ягод (MBV), общий объем ягод (TBV), длину рахиса (RL), длину плеча (SL) и вес рахиса (RW) (Интернет-ресурс 4). Значения длин стеблей (PL), участков междоузлий (L1I, L2I) и длины цветоножек (PED) у Gm20-13 и FkCH были стабильными и не различались в зависимости от местоположения и сезона (Интернет-ресурс 4).

Чтобы отразить влияние различных условий виноградника, которые могут повлиять на архитектуру кластера, годовой прирост древесины был зарегистрирован как индикатор жизнеспособности растений (Таблица 3). Значения клонов Gm20-13 и FkCH, полученные в течение сезонов 2015 и 2016 годов, значительно различались между тремя локациями (Интернет-ресурс 1). Наибольший прирост древесины с одной лозы был достигнут в Бадене (в среднем 1136 г, интегрированное управление), за ним следуют Гессен (в среднем 758 г, интегрированное управление) и Пфальц (в среднем 456 г, виноградник под органическим управлением).На прирост древесины (WG) сезон существенно не повлиял (Интернет-ресурс 4).

В таблице 3 приведены результаты морфометрической характеристики гроздей. Слабо сгруппированные клоны из Фрайбурга (Fr12L, Fr13L) и из Вайнсберга (WeM1, WeM171, WeM242) имели большую длину позвоночника и увеличенный объем ягод. Клоны Fr12L, Fr13L и WeM242 показали увеличенную длину ножек, как и клон Gm1-86 из Гейзенхайма со слабой кластеризацией. Однако последний клон (Gm1-86) образовывал более короткие рахисы.Компактные клоны PN обычно давали маленькие ягоды с короткими цветоножками и уменьшенной длиной рахиса. Анализ также включал смешанные клоны с ягодами, которые различались по объему и количеству ягод по сравнению с их соплеменниками из тех же линий клональной селекции. Клоны PN Gm20-13 и Frank Charisma были доступны на всех виноградниках и измерялись в любое время года. Эти данные позволили изучить влияние окружающей среды (фактор «местоположение» и «сезон») на морфологию гроздей, как показано на рис.2. Все морфометрические измерения служили для изучения дифференциальной экспрессии генов в связи с характеристиками архитектуры кластера.

Рис. 2.

Влияние мест отбора проб и вегетационного периода на отдельные суб-черты кластерной архитектуры и прирост древесины для клонов «Пино Нуар» Gm20-13 и FkCH. Эти два клона могут быть отобраны для всех сезонов и мест. Среднее значение и 95% доверительные интервалы оценивались с помощью обобщенных линейных моделей (n = 120). Подтипы СА: длина рахиса (RL), длина плеча (SL) и средний объем ягод (MBV) явно зависели от «сезона».Напротив, длина цветоножки (PED) не зависела ни от «сезона», ни от «местоположения» (Интернет-ресурс 4).

Идентификация регулируемых генов и экспрессия VvGRF4

Гены-кандидаты были выбраны из предыдущего исследования RNA-Seq и литературных ссылок (Интернет-ресурс 3). Ген VvGRF4 был включен, чтобы проверить его общее значение для компактности кластера в расширенном наборе PN-клонов из различных фонов селекции и в разных средах. Клон Gm20-13 имел отчетливый фенотип (маленькие ягоды, короткие рахисы) и использовался в качестве эталона для стандартизации данных экспрессии генов, противопоставляя его экспрессию данным тех клонов, которые демонстрируют признаки длинного рахиса и большой объем ягод.

Сообщалось об ускоренном росте соцветий рыхлых по сравнению с компактно сгруппированными клонами PN непосредственно перед цветением (BBCH57) и в период раннего завязывания плодов (BBCH71) (Richter et al., 2017). Следовательно, эти временные точки были выбраны для анализа экспрессии 91 гена в 11 клонах PN, классифицированных по их кластерной архитектуре (рисунок 3, таблица 2). Количественная ПЦР в реальном времени была проведена на развитых соцветиях (BBCH51) и молодых гроздьях при завязывании плодов (BBCH71).

Рисунок 3.

Для исследований дифференциальной экспрессии генов для анализа экспрессии генов использовали образцы BBCH57 (a) (непосредственно перед цветением с закрытыми крышечками цветков (b)) и BBCH71 (c) (набор ягод). Для каждой временной точки были собраны три биологические реплики с разных лоз. Отобранные виноградные лозы были выбраны случайным образом на плантации из нескольких сотен особей каждого клонального варианта. Были отобраны только виноградные лозы без каких-либо признаков патогенной инфекции или физиологического расстройства.

Всего 40 генов на BBCH57 и 81 ген на BBCH71 оказались по-разному экспрессируемыми между клонами PN фенотипа LCC, MBC или CCC (Интернет-ресурс 5).Из них 15 дифференциально экспрессируемых генов были выведены с помощью умеренной Т-статистики с использованием эмпирического байесовского моделирования (Smyth 2004). Эти 15 генов по-разному экспрессировались автономно, то есть независимо от «сезона» и «местоположения». Они включали ген, кодирующий фактор транскрипции VvGRF4, как и ожидалось из предыдущего исследования Россманна и др. (2019), оцениваемого здесь в более крупном наборе клонов. VvGRF4 дифференциально экспрессировался как на BBCH57, так и на BBCH71. В соответствии с предыдущими результатами, его активность была высокой в ​​клонах LCC и подавлялась в CCC (рисунок 4, рисунок 5).Экспрессия VvGRF4 в MBC напоминала паттерн, наблюдаемый в CCC. Помимо VvGRF4, два гена (VIT_04s0008g01100 и VIT_18s0001g03160) были последовательно дифференциально активны на ранней стадии BBCH57 (рис. 4).

Рисунок 4. Тепловая карта

усредненных (три биологических и два технических повтора) значений относительной экспрессии генов в виде log (2) FC (-ΔΔC t ) выбранных генов на BBCH57. Экспрессию гена относительно среднего значения GAPDH и UBIc анализировали непосредственно перед цветением (BBCH57) и стандартизировали относительно клона PN Gm20-13.Строки показывают относительную экспрессию генов. В столбцах представлены образцы «Пино Нуар». Клоны указаны внизу с их сокращенным названием, их местонахождением (B = Баден, H = Гессен, P = Пфальц) и годом отбора проб (15 = 2015, 16 = 2016, 17 = 2017). Иерархическая кластеризация (на основе евклидовых расстояний) выявила сходство в регуляции генов в клонах PN в зависимости от их типа кластерной архитектуры (CA). LCC отделены от CCC и MBC.

Рисунок 5.

Тепловая карта усредненных (три биологических и два технических повтора) значений относительной экспрессии генов в виде log (2) FC (-ΔΔC t ) выбранных генов на BBCH71. Экспрессию гена относительно среднего значения GAPDH и UBIc анализировали сразу после цветения (BBCH71) и стандартизировали относительно клона PN Gm20-13. Строки показывают относительную экспрессию генов. В столбцах представлены образцы «Пино Нуар». Клоны указаны внизу с их сокращенным названием, их местонахождением (B = Баден, H = Гессен, P = Пфальц) и годом отбора проб (15 = 2015, 16 = 2016, 17 = 2017).Иерархическая кластеризация (на основе евклидовых расстояний) выявила сходство в регуляции генов в клонах PN в зависимости от их типа кластерной архитектуры (CA). LCC отделены от CCC и MBC. Данные по экспрессии генов образуют пять кластеров схожих паттернов (как указано цифрами слева).

После завязывания плодов и начала развития плодов (BBCH71) было обнаружено, что еще 11 генов по-разному экспрессируются между рыхлыми и компактными клонами PN во все сезоны и места.Их регуляция достигла большей амплитуды, чем на молодой стадии (BBCH57). К их значениям выражений была применена иерархическая кластеризация. Вместе с VvGRF4 гены были сгруппированы в пять кластеров в соответствии с паттернами их экспрессии (таблица 4, фиг.5). Кластеризация клонов PN показала четкое разделение LCC от CCC и MBC (фиг.5).

В кластере экспрессии I гены, связанные с транспортом и фитогормонами, VIT_04s0008g01100, VIT_08s0007g01370, VIT_18s0001g03160 и VIT_18s0001g04890 подавлялись в большинстве LCC, в то время как в большинстве LCC и CCC они демонстрировали лишь незначительные изменения экспрессии.Ген VvGRF4 образовывал отдельный кластер II и следовал гомогенному паттерну дифференциальной экспрессии, специфичному для свободных соответственно. компактные и смешанно-ягодные клоны. Он был очень активен в клонах LCC. Кластер III содержал гены VIT_17s0000g05000, VIT_18s0001g03540 и VIT_18s0001g11160. Продукты этих генов связаны с регуляцией транскрипции (транскрипционный фактор SEPALLATA1-подобный), транспортом ауксина и гомеостазом ауксина. В большинстве LCC они были активированы в гораздо большей степени, чем в CCC.Кластер IV состоит из гена VIT_01s0026g02030. Он кодирует не связывающий ДНК основной фактор транскрипции спираль-петля-спираль (bHLH) PRE6. Для этого гена фактора транскрипции LCC показали более высокую экспрессию, чем CCC. MBC показали гетерогенный диапазон дифференциальной экспрессии от -4,35 до 0,39. В кластере V паттерны экспрессии показали самую высокую гетерогенность. Гены VIT_01s0010g02430, VIT_01s0127g00870, VIT_17s0000g03750 и VIT_17s0053g00990 кодируют белки, связанные с синтезом клеточной стенки или клеточным ростом.Продукты генов VIT_02s0025g04720 (LDOX) и VIT_18s0001g05060 (2,3-бифосфоглицерат-зависимая фосфоглицерат-мутаза) связаны с синтезом про-антоцианидина соответственно. гликолиз / глюконеогенез. Несколько образцов CCC показали дивергентную (активную) экспрессию генов, на которую влияют «сезон» и «местоположение» (например, Hesse 2015). Образцы LCC из Пфальца показали репрессию для четырех генов в кластере V в отличие от клонов из других мест (рис. 5). Изменения выражений приведены в таблице 4.

Вариативность экспрессии гена, объясняемая экспериментальными факторами

Для того, чтобы определить, в какой степени модуляции экспрессии гена были затронуты экспериментальными факторами, помимо их взаимосвязи с архитектурой кластера, был проведен анализ распределения дисперсии. Для всех идентифицированных генов фактор «тип кластера» объясняет значительный процент дисперсии экспрессии генов (рис. 6, Интернет-ресурс 8). Факторы «местоположение» и «сезон» также показали явное влияние.

Рисунок 6.

Анализ распределения дисперсии с использованием экспериментальных факторов для оценки процента объясненной дисперсии экспрессии гена. Графики скрипки (a, c) показывают объясненные отклонения в общих значениях экспрессии генов log (2) (ΔC t ) по оси Y, тогда как ось X отображает факторы дисперсии: тип кластера (свободный , смешанные ягоды, компактные), биоповторы, (биологические повторы, n = 3), сезон, партия (технические повторы, n = 2), местоположение, генофонд (фон селекции), клон (11 клонов 'Pinot Noir') и остатки.Гистограммы (b, d) отображают величину вариации, объясняемую каждым фактором в экспрессии отдельного гена.

В ранний момент времени, BBCH57, основной причиной дисперсии для VvGRF4 был «кластерный тип» (объясненная дисперсия 58%). Для VIT_18s0001g03160 (вакуумный переносчик ауксина) это был «сезон» (26%). Дисперсия VIT_04s0008g01100 (цитохром P450 711A1) в основном объяснялась фактором «местоположение» (22%).

На более поздней стадии развития BBCH71 фактор «кластерного типа» был основным детерминантом вариабельности экспрессии почти всех 15 исследованных генов.Единственным исключением был VIT_18s0001g03540 (только 14% дисперсии объяснялись «типом кластера»). Дисперсия экспрессии гена VvGRF4 более чем на 80% объяснялась «кластерным типом». Однако фактор «сезон» был важным детерминантом вариации экспрессии генов, объясняющей более 20% вариации для генов VIT_08s0007g01370, VIT_17s0000g05000, VIT_17s0053g00990 и VIT_18s0001g03540 (рис. 6, Интернет-ресурс 8).

На ген VIT_18s0001g04890 сильно повлиял фактор «партии» (технические реплики), а гены VIT_01s0010g02430, VIT_01s0026g02030, VIT_01s0127g00870 и VIT_18s0001g11160 варьировались в биологических репликах (онлайн-ресурс 8).

Корреляция экспрессии гена с суб-признаками кластерной архитектуры

На ранней стадии BBCH57 относительная экспрессия VvGRF4 (log (2) FC) сильно коррелировала со средним объемом ягод суб-признаков кластерной архитектуры ( MBV; r = 0,87 / 0,90) и длине цветоножек (PED; r = 0,92 / 0,89) в оба года. Напротив, транскрипция генов VIT_04s0008g01100 и VIT_18s0001g03160 обратно коррелировала с MBV и PED (таблица 5). Не было значимой корреляции с длиной плеча (SL).

В течение 2015 и 2016 годов, на стадии развития BBCH71, все отобранные гены изменили экспрессию, что коррелировало по крайней мере с одним из суб-признаков CA: средний объем ягод (MBV), длина плодоножки (PED) и длина плеча (SL) (Таблица 5) . В обоих сезонах проявились три основных тренда. I) 11 генов со значительной корреляцией с MBV также коррелировали с PED. Гены с корреляцией с SL часто коррелируют с энергией растений (измеряется как прирост древесины, WG). II) Корреляции между MBV / PED в целом оказались обратными корреляциям, наблюдаемым для SL / WG (Таблица 5, Интернет-ресурс 7).III). Ни один из 15 генов не продемонстрировал какой-либо значимой корреляции с количеством ягод (BN), массой кластера (CW) или длиной позвоночника (RL) CA-подвидов (Интернет-ресурс 7).

Интересно, что у BBCH71 корреляция экспрессии генов с MBV в целом была сильнее, чем с PED. Эта тенденция не наблюдалась для трех генов, регулируемых на ранней стадии BBCH57, где обе корреляции были примерно одинаковыми по силе. Все гены показали, что регуляция экспрессии коррелирует с длиной плеча (SL) суб-признака, по крайней мере, в одном сезоне.

Корреляция дифференциальной экспрессии генов между модулированными генами

В целом корреляция между дифференциально экспрессируемыми генами была сильной, за единственным исключением VIT_18s0001g03540 (Интернет-ресурс 6).

В соответствии с кластерами экспрессии генов (рисунки 4 и 5), гены, которые были положительно коррелированы с MBV и PED, также положительно коррелировали с генами экспрессионных кластеров со II по V, но отрицательно с генами кластера I (Интернет-ресурс 7).И наоборот, гены, которые отрицательно коррелировали с MBV и PED, также отрицательно коррелировали со всеми генами в кластерах экспрессии со II по V, но положительно с генами в кластере I (Интернет-ресурс 7).

Три гена VIT_01s0026g02030, VvGRF4 и VIT_17s0000g05000 кодируют предполагаемые факторы транскрипции. На BBCH57 экспрессия VvGRF4 отрицательно коррелировала с генами, дифференциально экспрессируемыми на этой стадии развития. Эта отрицательная корреляция сохранилась и на более поздней стадии. На BBCH71 экспрессия десяти регулируемых генов всегда коррелировала с транскрипционной активностью трех генов факторов транскрипции в одном и том же смысле.Три гена факторов транскрипции положительно коррелировали друг с другом. Ген VIT_18s0001g04890 коррелировал с VIT_17s0000g05000 только в течение сезона 2015 г. (таблица 6).

Таблица 6.

Коэффициент корреляции для относительной экспрессии генов (log (2) FC) между тремя предполагаемыми факторами транскрипции и дифференциально регулируемыми генами. Корреляция Спирмена (r) значима при * p <0,05, ** p <0,01, *** p <0,001 и **** p <0,0001 Положительная корреляция отмечена пурпурным цветом, отрицательная корреляция - голубым.

Обсуждение

Это исследование было направлено на идентификацию генов, участвующих в определении рыхлой кластерной архитектуры в клонах «Пино Нуар» (PN), и на проверку общности значения VvGRF4, недавно определенного как важный регулятор архитектуры кластера (Россманн и др., 2019). В этом контексте 12 различных клонов PN с различными типами кластерной архитектуры были подробно изучены на предмет их суб-признаков, которые определяют общий фенотип. Расширяя диапазон типов кластерной архитектуры, исследованных в предыдущем исследовании (которое проводилось только на двух свободных и двух компактных клонах PN), кластерный тип «смешанных ягод-клонов» был добавлен к компактным и слабо кластеризованным клонам PN.Стадия развития начала формирования ягод была исследована на предмет регуляции генов как важный этап формирования окончательного размера ягод.

Клоны PN были изучены на двух (фенотипирование) соотв. три (для анализа экспрессии генов) сезона в трех разных средах, чтобы определить суб-черты кластерной архитектуры и их ответственные гены, которые действуют независимо от местных и сезонных условий. Как указано в обзоре Гришкевича и Янаи (2013), фенотип организма определяется комбинацией его генотипа (G), окружающей среды (E) и их взаимодействия (G × E).Следовательно, желательно избавиться от большого количества клональных особей, разбросанных по нескольким местам. Однако для многолетних культур, таких как виноград, это требование выполнить сложно. Создание контролируемых виноградников, выращенных из сертифицированного растительного материала с достаточным количеством материала для случайного отбора проб, требует много времени и больших затрат. Клоны PN в этом исследовании необходимо было выращивать на гомогенных участках и прививать к одному и тому же сорту подвоя, чтобы избежать транскриптомных сдвигов в привое и значительного влияния на урожайность и жизнеспособность подвоя (Chitarra et al.2017). Поэтому эксперименты здесь были ограничены клональным материалом, доступным в сотрудничающих питомниках и хранилище сортов в Институте (Geilweilerhof). Три плантации управлялись по-разному (органическое виноградарство в Гейлвайлерхофе, интегрированное управление в питомниках), что должно ограничивать идентификацию генетических компонентов с теми, которые действуют автономно от условий окружающей среды.

Клоны FkCH и Gm20-13 присутствовали во всех трех местах и ​​позволили оценить влияние окружающей среды на фенотип кластерной архитектуры и дифференциальную экспрессию вовлеченных генов.WG (прирост древесины) и RL (длина рахиса) сильно зависели от условий окружающей среды, в то время как особенно PED (длина цветоножки) стабильно дифференцировал эти рыхлые (Gm20-13) и компактные (FkCH) клоны, независимо от местоположения виноградника. .

При исследовании характеристик кластерной архитектуры для всех клонов суб-черты MBV (средний объем ягод), количество ягод (BN), RL (длина рахиса), SL (длина плеча) и PED (длина плодоножек) были выявлены как наиболее актуален для выражения общей архитектуры кластера.

Дифференциальная экспрессия генов-кандидатов изучалась точно в то время, когда фенотипические признаки меняются между клонами со слабой кластеризацией и клонами с компактной кластеризацией. Это соответствует фазе ускоренного роста рахиса у молодых развивающихся рыхлых гроздей по сравнению с компактными и смешанными ягодными клонами (Richter et al., 2017). Это приводит к увеличению числа клеток на ножках (Россманн и др., 2019)

Для анализа экспрессии генов стандартный клон Gm20-13 с его отличным фенотипом характерно мелких ягод и короткого позвоночника использовался в качестве эталона для стандартизации экспрессии генов в 12 клетках. Клоны PN.Работа была сосредоточена на 15 генах, которые по-разному экспрессировались во время развития кластера в различных условиях окружающей среды. К ним относятся ген, кодирующий VvGRF4, и подтверждено его значение в регуляции кластерного фенотипа (Интернет-ресурс 6). Однако на регуляцию этих генов повлияли экологические и экспериментальные колебания. Тем не менее, анализ части дисперсии, объясняемой факторами выборки и окружающей среды, в дополнение к архитектуре кластера, подтвердил значительный процент вариации их экспрессии, связанной с фенотипом компактности сгустка (Рисунок 6).

Из 91 протестированного гена три гена на BBCH57 и еще 12 генов на BBCH71 проявили регуляцию, связанную с архитектурой кластера во всех местах и ​​во все времена года. Образцы, полученные в период до цветения, показали меньшую вариативность, связанную с архитектурой кластера, и большую вариацию из-за местоположения и сезона (рис. 6, Интернет-ресурс 8), чем на более поздней стадии. Это соответствует наблюдению Dal Santo et al. (2018), которые определили факторы «стадия развития», «сезон» и «местоположение», которые влияют на общую транскрипционную изменчивость в течение трех сезонов у двух сортов винограда.

На ранней стадии BBCH57 экспрессия VvGRF4 уже усиливалась в клонах со слабой кластеризацией и, наоборот, подавлялась в компактных и смешанных клонах с ягодами. В этот момент наблюдалась тонкая модуляция генов VIT_04s0008g01100 и VIT_18s0001g03160. Эти два гена входят в кластер I регуляторных групп генов более поздней стадии (BBCH71). В целом, они по-прежнему демонстрировали умеренные изменения экспрессии при завязывании плодов с более явной активацией в компактных и смешанных клонах с ягодами.VIT_18s0001g03160 аннотируется как ген, кодирующий WAT1 («тонкие стенки»), вакуолярный переносчик ауксина, охарактеризованный у Arabidopsis (Ranocha et al. 2013). Ген VIT_04s0008g01100 кодирует гомолог цитохрома 450 711A1, монооксигеназы, участвующей в метаболизме стриголактонов (превращение карлактона в карлактоновую кислоту). Его функция была идентифицирована в мутации MAX1 у Arabidopsis, которая показывает усиленный подмышечный рост. MAX1 подавляет ветвление побегов у Arabidopsis (Abe et al.2014). Это исследование указывает на дополнительные или различные функции этих генов в виноградной лозе. Гены кластера I с понижающей регуляцией в рыхлых кластерах также включают VIT_18s0001g04890, аннотированный как переносчик сульфата. Было описано, что два гена, VIT_18s0001g04890 и VIT_18s0001g03160, репрессируются в клонах Garnacha Tinta с более крупными ягодами (Grimplet et al., 2017). Это согласуется с нашими результатами здесь для клонов «Пино Нуар», поскольку высокий MBV (средний объем ягод) соответствует крупным ягодам, которые являются важным определяющим фактором для рыхлых гроздей.

Помимо гена, кодирующего VvGRF4, который определенно был выше экспрессирован в клонах LCC на BBCH71 (Интернет-ресурс 6), гены с автономной повышающей регуляцией, особенно в LCC, включали VIT_17s0000g05000. Этот ген кодирует регулятор развития, подобный SEPALLATA 1. Вероятно, он выполняет функцию фактора транскрипции и, как известно, является частью сети, которая регулирует развитие цветка у Arabidopsis, где он предотвращает неопределенный рост меристемы цветка (Pelaz et al. 2000).Недавно Palumbo et al. (2019) сообщили о VIT_17s0000g05000 как о гомеотическом гене, связанном с дифференцировкой мутовок у виноградных лоз в период от предварительного цветения до постоплодотворения. В этом исследовании смешанные клоны PN с ягодами Gm20-13 (стандарт с коротким позвоночником) и Fr1801 (длинный стержень) показали самую высокую дифференциальную экспрессию VIT_17s0000g05000 во все три сезона и во всех доступных местах фруктового стета, но не в начале. стадия цветения. Эти два клона различаются в основном длиной рахиса.Таким образом, VIT_17s0000g05000 представляет собой интересного кандидата, контролирующего проявление длины рахиса. Он явно подавляется при фенотипе длинного осевого позвонка (Fr1801). Возможно, этот гомолог SEPALLATA участвует не только в формировании цветков, но и в дальнейшем в развитии кустистой оболочки.

В дополнение к функциям транспорта ауксина (VIT_18s0001g03540) и гомеостазу ауксина (VIT_18s0001g11160, Mizu-KusselI (Moriwaki et al. 2011)), экспрессия гена фактора транскрипции PRE6 была значительно усилена в LCC.Он относится к атипичным факторам транскрипции bHLH, не обладающим прямой способностью связываться с ДНК, которые опосредуют передачу ауксина, брассиностероида и светового сигнала и влияют на фотоморфогенез. Гомолог из риса, названный ILI1 (увеличенный наклон пластинки 1), увеличивает удлинение клеток (Zhang et al. 2009). Удлинение клеток может вносить вклад в важные особенности кластера, такие как длина рахиса и длина плеча. Дополнительные гены с повышающей регуляцией, особенно в рыхлых кластерных клонах PN, охватывают функции, участвующие в удлинении клеточной стенки (VIT_17s0053g00990), размере клетки (VIT_01s0127g00870) и делении клеток (VIT_01s0010g02430).Ген VIT_17s0053g00990 кодирует α-экспансин, который, как было обнаружено, активируется в быстрорастущих виноградных ягодах и увеличивает размер клеток (Suzuki et al. 2015).

Интересно, что два клона Gm1-86 и Gm20-13, оба происходящие из линии селекции в Гейзенхайме, различаются числом ягод (таблица 3). Это фенотипическое различие соответствует повышенной экспрессии VvGRF4 и гена VIT_01s0127g00870 (бета-подобный белок 1 Vitis vinifera polygalacturonase 1) в Gm1-86, клоне с более высоким числом ягод.Активность VIT_18s0001g04890 (транспортера сульфата) была снижена в Gm1-86 по сравнению с Gm20-13. Однако этот ген, кодирующий переносчик сульфата, показал высокую вариабельность (34%) в технических репликах (Интернет-ресурс 8).

В предыдущем генетическом исследовании кластеры QTL, связанные с рыхлой архитектурой пучка, были локализованы на полностью независимом генетическом фоне (Richter et al., 2018). Массивы перекрывающихся областей QTL были обнаружены на семи хромосомах, включая хромосому 1 и 17.Интересно, что три гена VIT_01s0026g02030 (PRE6), VIT_17s0000g05000 (SEPI), VIT_17s0053g00990 (кодирующий α-экспансин), связанные с различными характеристиками кластерной архитектуры, обнаруженными здесь для клонов PN, расположены в областях QTL. Два из них являются факторами транскрипции, которые могут выполнять комплексную функцию, которая требует дальнейшего изучения.

Выводы

В этом исследовании изучалась экспрессия генов в клонах «Пино Нуар» с разной кластерной архитектурой, выращиваемых в нескольких местах в течение трех сезонов.Он выявил 15 генов, которые по-разному регулируются между свободно и компактно сгруппированными клонами, независимо от года и местоположения (или любых других встречающихся изменений окружающей среды). Это подтвердило важную роль VvGRF4 в регулировании кластерной архитектуры «Пино Нуар». Он недавно идентифицировал еще два гена факторов транскрипции, гомолог SEPALLATA1 и гомолог PRE6, которые более активны в клонах со слабой кластеризацией, чем в клонах с компактной связкой. По сравнению с недавней литературой, эти гены-регуляторы могут иметь новые или дополнительные функции, влияющие на структуру грозди винограда «Пино Нуар».Кроме того, было обнаружено, что гены, участвующие в метаболизме ауксина, клеточном росте и транспорте, регулируются. Также был задействован гомолог гена CYP711A1, кодирующего фермент метаболизма стриголактона. Стриголактоны действуют как ингибиторы ветвления побегов (Gomez-Roldan et al. 2008). Этот ген репрессируется в рыхлых кластерах, возможно, вызывая некоторое подавление, и, таким образом, кажется, способствует фенотипу рыхлых кластеров у винограда.

Эти результаты улучшают базовые знания о фенотипе гроздей виноградной лозы.Это исследование выявило несколько основных регуляторов кластерной архитектуры в «Пино Нуар», которые заслуживают дальнейшего внимания и функциональных исследований. Исследования генетического разнообразия таких основных генов-регуляторов у других сортов V. vinifera покажут, применимы ли они в качестве молекулярных инструментов для селекции выгодных сортов винограда со слабой кластеризацией и повышенной устойчивостью к Botrytiscinerea.

Заявления

Конфликт интересов

Авторы заявляют об отсутствии конфликта интересов.

Вклад

Исследование разработали EZ и RR. EZ получила финансирование и руководила работой. Компания RR провела эксперименты, измерения и расчеты. SR и KT предоставили данные о секвенировании РНК.

DG предоставил статистическую экспертизу. RT предоставил растительный материал, инфраструктуру и специальные консультации. RR и EZ написали статью. Все авторы читают рукопись.

Дополнительная информация сопровождает рукопись на веб-сайте теоретической и прикладной генетики.

Выражение признательности

Эта работа финансировалась «Федеральной программой экологического землепользования и других форм устойчивого сельского хозяйства» (Bundesprogramm Ökologischer Landbau und andere Formen nachhaltiger Landwirtschaft, BÖLN) BLE (Bundesanstaltchaft für und Landnulture). Еда под названием «MATA-Molekulare Analyze der Traubenarchitektur» (Молекулярный анализ кластерной архитектуры) FKZ 2811NA056 (www.ble.de). Мы благодарим Даниэля Зендлера за плодотворное обсуждение и Маргарету Шнайдер за техническую помощь.Мы хотели бы поблагодарить питомники винограда Reben Sibbus GmbH, Засбах-Йехтинген, Германия и Antes Viticulture & Grafting GbR, Хеппенхайм, Германия за предоставление доступа к их клональному материалу и поддержание опытных полей в Бадене и Гессене.

Каталожные номера

  1. 9048
    1. 9048
    2. Fox J, Weisberg S (2011) An {R} Companion to Applied Regression, Second edn.[SAGE], Thousand Oaks CA

    3. 0 9048 9048 9048 9048 9048 9048 9048 9048 9048 9048 ↵

      Konrad H, Lindner B, Bleser E, Rühl EH (2003) Стратегии генетического отбора клонов и сохранения генетического разнообразия внутри сортов. 603 изд. Международное общество садоводческих наук (ISHS), Левен, Бельгия, стр. 105–110

        1. 9048 9048
        2. Sapkota SD, Chen LL, Yang S, Hyma KE, Cadle-Davidson LE, Hwang CF (2019) Количественное картирование локусов признаков ложной мучнистой росы и устойчивости гроздей ботритиса в полученном из Vitis ais 'Norton' на основе населения.1248 изд. Международное общество садоводческих наук (ISHS), Лёвен, Бельгия, стр. 305–312

        3. 905 9048

        Поверхностный рост на верхушке репродуктивного побега Arabidopsis thaliana булавочной формы 1 и дикого типа по JSTOR

        Abstract

        С помощью метода неразрушающих реплик и вычислительного протокола, геометрия поверхности и расширение на верхушке репродуктивного побега анализируются для шипованного 1 (pin1) Arabidopsis thaliana и сравниваются с диким типом.Наблюдаемая сложность геометрии и расширения на вершине стержня 1 указывает на то, что оба компонента роста вершины побега, то есть самовоспроизводство меристемы и инициирование боковых органов, реализуются вершиной стержня 1. Однако реализация последнего компонента завершается лишь от случая к случаю. Вершина pin1 обычно имеет куполообразную форму, но ее кривизна неоднородна, особенно позже, в онтогенезе вершины, когда на ее периферии появляются выпуклости и седловидные области. Единственные седловидные области на вершине побега дикого типа - складки, отделяющие зачатки цветков от меристемы.Расширение поверхности на вершине pin1 происходит быстрее, чем у дикого типа. Как у pin1, так и у дикого типа поверхность вершины дифференцирована на области с различной скоростью ареальной деформации. На вершине pin1, но не у дикого типа, эти области соответствуют геометрически различающимся центральной и периферической зонам. Расширение центральной зоны вершины штифта 1 почти изотропно и медленнее, чем в периферической зоне. Периферийная зона разделена на кольцевые участки с различной анизотропией расширения.Дистальная часть этой зоны расширяется анизотропно, подобно регионам периферии верхушки дикого типа, которые контактируют с более старыми зачатками цветка. Проксимальная часть расширяется почти изотропно, как места зарождения цветков у дикого типа. Периферийная зона в pin1 окружена «базальной зоной», зоной sui generis, где скорости поверхностной деформации низкие, а расширение является анизотропным. Обсуждаются возможные отношения между наблюдаемыми регионами разной экспансии и различными паттернами экспрессии генов в вершине pin1, известными из литературы.

        Journal Information

        Цель JXB - публиковать рукописи высочайшего качества, в которых рассматриваются вопросы, представляющие широкий интерес в биологии растений. Мы приветствуем рукописи, которые определяют фундаментальные механизмы, в том числе лежащие в основе улучшения растений для устойчивого производства продуктов питания, топлива и возобновляемых материалов. Мы делаем упор на молекулярную физиологию, молекулярную генетику и физиологию окружающей среды, и мы поощряем интегративные подходы с использованием передовых технологий, системной биологии и синтетической биологии.

        Информация об издателе

        Oxford University Press - это отделение Оксфордского университета. Издание во всем мире способствует достижению цели университета в области исследований, стипендий и образования. OUP - крупнейшая в мире университетская пресса с самым широким глобальным присутствием. В настоящее время он издает более 6000 новых публикаций в год, имеет офисы примерно в пятидесяти странах и насчитывает более 5500 сотрудников по всему миру. Он стал известен миллионам людей благодаря разнообразной издательской программе, которая включает научные работы по всем академическим дисциплинам, библии, музыку, школьные и университетские учебники, книги по бизнесу, словари и справочники, а также академические журналы.

        Coduri erori centrale Viessmann - Revizii Centrale Gaz

        Resetarea la central Viessmann Vitodens 050 репрезентация anularea репетитор mesajelor de eroare. Aceasta se efectueaza apasand simultan butoanele MODE si OK timp de trei secunde. In cazul in care dupa repornirea centralei termice mesajele de eroare persista, apelati la echipa noastra de service autorizata Iscir. Al doilea mod de resetare a uni central Viessmann este inchiderea aparatelor prin apasarea butoanelor 0 si 1.Aceasta metoda nu anuleaza toate erorile de functionare, ci doar o parte dintre ele.

        Cod de eroare F2 la central Viessmann Vitodens 050
        Eroarea F2 poate semnala lipsa apei в aparat sau lipsa de presiune. Verificatinivelul de umplere a instalatiei si functionarea pompei de cycle. Lipsa de presiune poate fi si un semn ca trebuie sa aerisiti instalatia termica. Dupa efectuarea verificarilor, incercati resetarea centralei termice Viessmann Vitodens 050 prin metoda descrisa mai sus.

        Cod de eroare F5 la centrala termica Viessmann
        In cazul in care va apare codul de avarie F5 la centrala Viessmann, независимая от модели, работает над семнализацией с порнестой искусственной вентиляции легких. Sunt cateva cause care pottermina nefunctionarea acestei component: placa de baza este defecta. Cabluri Intrerupte Care Alimenteaza Ventilatorul sau acesta este blocat.

        Resetare centrala Viessmann la code de eroare F4
        La codul de eroare F4, o centrala Viessmann se comporta ca si cand nu ar exista gaz la arzator.Cea mai probabila cauza poate fi electrovalva inchisa sau este o problem de la Furnizorul de gaze. Подтверждено, что это происходит с помощью двойного электрического клапана и сброса центрального терминала с помощью метода mai sus.

        Codurile de avarie pe care le-am descries mai sus sunt valabile pentru toate modelele decentrale Viessmann. Orice проблема ухода персиста sau care se declanseza incusiv dupa resetarea centralei, necesita interventia personalului autorizat.

        Nejčastější poruchy a chybová hlášení kotle - řešení

        Ať už si vybereme kotel na pevná paliva, plynový nebo elektrický, jedno mají společně.Vždy může nastat moment, kdy se objeví chybové hlášení. Určitě to znáte i vy. На дисплеи začnou blikat neznámé čísla, nedejbože, i в kombinaci s písmeny. Nemáte číslo na servis a pokud jo, tak neodpovídají? Ztratili jste knížku s návodem? Невади. Мой jsme pro vás sepsali nejčastěji chybová hlášení kotle, právě pro tyto příležitosti. Vždy je však důležité kontaktovat servisního technika, který jako odborník váš kotel prohlédne, pomůže vám vyřešit problém a předcházet dalším. Proto jsme přidali i stránky, kde si můžete kontakt vyhledat pro efektivnější řešení.

        Chybová hlášení kotle - navigace v článku

        Typy kotlů, nejběžnější poruchy a jak jim předcházet

        Známe tři základní typyžíčéva.

        • plynový Kotel
        • elektrický Kotel
        • Kotel на Tuha paliva

        Výběr správného Kotle ovlivňuje РАДА faktorů:

        • Počet LIDI против domácnosti
        • umístění zařízení
        • velikost tepelných ztrát objektu
        • Jiné

        Прото JE důležité abyste poradili s odborníkem, který vám pomže při rozhodování.Správným výběrem předejdete mnoho nepříjemnostem a vyhnete se zbytečně opuštěným penězům. Špatná volba kotli je častou příčinou zobrazování chybových hlášení.

        Nejčastější poruchy Kotle

        Nejčastější poruchy plynového Kotle jsou:

        • zavřený uzávěr plynu
        • nefunkční Baterie против prostorovém termostatu
        • nefunkční elektrická zásuvka při plynovém termostatu
        • použití rozdvojky při plynovém Kotli против Elektricke zásuvce
        • nedostatečné množství воды в объекте ústředního topení
        • vysoká prašnost prostředí nebo zanedbaný servis

        Jak předcházet poruchám kotle

        Nejdležitější jeviside.Pokud podceníte servis a превентивный prohlídky, můžete si být více než jisti, že chybová hlášení budou objevovat častěji. Preventivní prohlídky se pohybují od 500-2600 Kč, pokud ovšem začnete dělat prohlídky pravidelně, bude stačit jedna za rok. Určitě je to lepší investice, než koupě nového kotle.

        Pravidelnou превентивный prohlídkou lze předcházet nepříjemným poruchám. Servisní technik vám může ukázat, jak si poradit v krizových situacích a jaké jsou možnosti. Главная мысль на безпечести дома.Найдите si svého servisního technika v okolí a svěřte mu svůj kotel do rukou. Tak se nejlépe zbavíte chybových hlášení kotle.

        Svěřte svůj kotel do rukou odborníka.

        Nejběžnější chybová hlášení kotle

        Může se stát nepříjemná situace, kdy naše topení selže, a nám je doma najednou zima nebo neteoda teplá v. На образовце котле гляси чибу а вы невите, як си порадить. Nejvhodnější řešení je zavolat servisního technika. Do Jeho příchodu však můžete zkusit zkontrolovat základní nastavení.Sepsali jsme pro vás nejčastější chybné hlášení kotle, které se mohou vyskytnout i u vás doma.

        Protherm

        Protherm je Německá značka pod záštitou Vaillant, která vyrábí kotle v Skalici už od roku 2001. Vyrábějí kotle zaměmecká značka pod záštitou Vaillant, která vyrábí kotle v Skalici už od roku 2001. Vyrábějí kotle zaměžíné? Díky nim je montáž kotlů poměrně lehčí a snižuje se riziko pochybení. Na svém kontě mají velké množství značek.

        • F0 Ztráta tlaku otopné vody - ztráta tlaku otopné vody (pod 0,6 bar), kotel je automaticky odstaven z provozu.Дополнительные воды в пределах 1-2 бара, последний коттедж имеет новую ценность.
        • F1 Přerušený snímač vratného potrubí - zkontrolujte snímač, zda je správně zapojen nebo zda nemá poruchu. Pokud je zapojen správně a nefunguje, zavolejte servisního technika. Je možné, že je snímač poškozen.
        • F3 Zvýšení teploty topné vody - překročení maximální teploty topné vody 95 ° C, выпустите и запустите котел, и это значит, что вы обновите по vychladnutí воду. Problém může být i v připojení s elektronikou zásobníku.Zkontrolujte zda je správně zapojen. Покудите непомузьте сетовані, заволейте технику....................................................... .Ство............................................................... Problém může být в занесенном черпадле небу фильтра. (u starších kotlů F3 = F20)
        • F4 Snímač teploty teplé vody je přerušen - kotel je odstaven z bežného provozu, ohřev zásobníku teplé vody se vypne. Topení by nemělo být ovlivněno. Zkontrolujte odpor snímače a přívodní kabely vedoucí z řídící desky do snímače. Pokud je vše na místě, je třeba zavolat technika.
        • F5 Поруча венковного чидла - правдеподобнее дошло ке зкрату небо к выпадению венковного чидла.Zkontrolujte správné připojení venkovního čidla. Porucha také signalizuje pokud jste zvolili způsob řízení kotle podle venkovní teploty a vnější čidlo nevlastníte. V tomto případě přestavte řízení kotle.
        • F6 Přerušení vnitřního čidla - zkontrolujte připojení senzoru nebo čidla. Zkontrolujte jeho nastavení, zda jsou správně. Пржи это поруше вшак нейлепши заволат сервис. Čidlo může být poškozeny a bude nutná výměna.
        • F10 Zkrat čidla topné vody na výstupu - zkontrolujte snímač, zda je správně zapojen nebo zda není poškozený kabel.Pokud jste nic nepoznali zavolejte servis, je možné, že snímač je poškozený a bude ho třeba vyměnit.
        • F20 (* F3) Přehřátí kotle - došlo k přehřátí kotle, ten se vypne a po vychladnutí obnoví svou činnost. Pokud se hlášení opakuje, zavolejte servis, může být ucpaný filter.
        • F22 Недостаточное множество вод - в системе топние воды. Котел - это автоматическая поставка из проволоки. Je třeba okruh topné vody doplnit správným množstvím обновить котел. Je však nejvhodnější zavolat servisního technika, který to udělá správně.
        • F28 (* F1) Ztráta plamene - došlo ke ztrátě plamene vlivem přerušení dodávky plynu do kotle. Vypněte a po chvilce znovu zapněte kotel hlavním vypínačem (RESET)

        * V starších ver. проблема. Na stránkách protherm.cz v sekci Servisní síť si pomocí vyhledávání lehko najdete, na koho se ve vašem okolí můžete obrátit.

        Junkers & Bosch

        Junkers se zaměřuje na celou řadu výrobků v oblasti tepelné techniky. Je součástí společnosti Bosch Termotechnika. Jejich výrobky jsou známé po celém světě a mají pod sebou 7 nejprodávanějších značek.

        • A2 nik spalin z komory hořáku - je třeba zkontrolovat výměník tepla, může být znečištěný, zavolejte servisního technika.
        • A3 Problém s přípojkami ventátoru nebo tlakového spínače - zkontrolujte přípojky, zda jsou správně zapojeny nebo nejsou poškozeny.
        • A3 idlo teploty spalin nebylo rozpoznáno - zkontrolujte bezpečnostní kontrolu spalin a jeho připojení.
        • A4 Poškození kontroly úniku spalin - nutná control čidla teploty spalin a připojovacích kabelů, zda nejsou přerušeny.
        • A7 Problém s idlem výstupu teplé vody - zkontrolujte idlo a jeho přípojky, zda jsou správně zapojeny.
        • A7 Problém s tepelným idlem teplé vody - можно использовать тепловые узлы,
        • A9 Nesprávně namontované tepelné čidlo teplé vody - třeba zkontrolovat místo montáže, popřípadě demontovat čidlo a znovu namontované s tepelně vodivou pastou. Входите в сервисную технику про правильную обработку.
        • CE Nízký tlak v topném zařízení - je třeba doplnit tlak v zařízení na 1,5 BAR. Zavolejte servisního technika.
        • EA Porucha plamene - zkontrolujte zda je plynový kohoutek otevřený, přívod přetlaku plynu, síťové připojení, zapalovací elektrody s kabelem a ionizační klektrody.Nejvhodnější je zavolat servisního technika.
        Kontakt na servis

        Pro odbornou radu a kvalitní odstranění poruchy kontaktujte servisního technika, který váš kotel změří a pomže vám při nepříjemných проблема. Na stránkách bosch-thermotechnology.com/cz/ najdete kontakt, kde vám poradí jak problém odstranit a jak mu předcházet.

        Viessmann

        Skupina Viessmann je Německá značka, která je jedním z mezinárodních výrobců topných, průmyslových a chladicích systémů.

        • AB Režim řízení - selhání čidla teploty, zkontrolujte zapojení kabelem, kontaktujte servisního technika.
        • EE Hořák je v poruchovém režimu - při spuštění hořáku je plamen příliš slabý. Zkontrolujte přívod a zapalování. Kontaktujte servisního technika.
        • 80 Řídící jednotka hořáku je v poruchovém stavu - systém, se ochlazuje. Ovládací jednotka hořáku byla zablokována, nastal zkrat čidla teploty topné vody. Вызкоушейте рестартовать котел. Určitě kontaktujte servisního technika.
        • A9 Komunikační chyba přístroje Open Them - zkontrolujte připojení, pro případné vyměněnu přístroje Open Them zavolejte servisního technika.
        • F1 Překročena maximální hodnota spalin - zkontrolujte stav naplnění topného zařízení a oběhové čerpadlo. Je třeba odvzdušnění zařízení. Kontaktujte servisního technika.
        • F2 Porucha hořáku - řídící jednotka je v poruchovém režimu, systém se ochlazuje. Zkontrolujte stav naplnění topného zařízení, oběhové čerpadlo a odvzdušněte zařízení.Zařízení restartujte a zavolejte servisního technika.
        • F2 Kódová karta - kódová karta nebyla vložena správně nebo se neshoduje s řídící jednotkou.
        • F4 Porucha hořáku - chybí signál plamene. Zkontrolujte zapalovací a ionizační elektrodu a spojovací kabely. Změřte tlak plynu a zkontrolujte plynový Regátor a zapalování. Následně proofte restartování kotle.
        • F5 Porucha tlakového spínače - tlakový spínač neukazuje žádný tlak, chyba elektronického připojení, uzavřený vent plynu, problémy se zásobováním plynu.Kontaktuje servisního technika.
        • F9 Nízké otáčky při startu hořáku - zkontrolujte ventátor, spojovací zařízení k ventátoru, napájení na fanátor a řízení fanátoru. Котел рестартуйте.
        • F10 Teplotní čidlo odpadního vzduchu - teplotní čidlo odpadního vzduchu je porušeno. Kontaktujte servisního technika.
        • FD Porucha řídící jednotky hořáku - systém se ochlazuje, řídící jednotka hořáku byla zablokována. Поруча снимаче тепла топные воды. Kontaktujte servisního technika.
        Kontakt na servis

        Pro bezpečnost vás a vaší rodiny vyhledejte servisního technika a předcházejte nepříjemnostem. Na stránce viessmann.cz si můžete vyžádat pracovníka servisu vyplněním formuláře, nebo telefonátem на горячей линии.

        Vaillant

        Vaillant je Německá značka, která na trhu působí více než 140 let. Má za sebou několik ocenění a stále se zdokonaluje.

        • F20 Omezovač teploty - umístění kabelů není správně, nebo je uvolněný kontakt.Zkontrolujte připojení. Zavolejte servisního technika.
        • F22 Недостаток воды - мало воды в котле, снимач тлаку воды е порушен, кабель к черпадлу небо снимачи воды е увольненный небо poškozený. Zavolejte servisního technika.
        • F24 Příliš rychlý nárůst teploty - čerpadlo zablokované, nižší výkon čerpadla, vzduch ve výrobku, příliš nízký tlak, gravitační brzda blokovalpatována nebo. Zavolejte servisního technika.
        • F26 Nefunkční plynový Ventilu - zkontrolujte připojení krokového motoru plynové armatury (plynového ventilu).Může být problém i s připojením konektoru na Des plošných spoj nebo je přerušen kontakt. Туто chybu může způsobovat i nefunkční elektronika. Je třeba kontaktovat servisního technika.
        • F28 Neúspěšné zapálení - нефункционный plynoměr nebo kontrolor tlaku plynu aktivován, vzduch v plynu, hydraulický tlak příliš malý, cesta kondenzátu tlak příliš malý, cesta kondenzátu tlak příliš ucpanánášáná. Zkuste restartovat zařízení. Kontaktujte servisního technika.
        • F29 Opakované neúspěšné zapálení - přívod plynu dočasně přerušen, cesta kondenzátu je ucpaná, zapalovací transformátor má výpadek.Restartujte zařízení. Kontaktujte servisního technika.
        • F36 Поруча в обводе спалина - контактная сервисная техника. Spaliny mohou být vypouštěny do ovzduší.
        • F61 Závada aktivace plynové armatury - plynová armatura se nemůže aktivovat, zkontrolujte kabely a připojení. Zavolejte servisního technika, je možné, že se armatura poškodila a bude ji třeba vyměnit.
        • F75 Жадна скокова идентификация пржи спуштени черпадла - снимач тлаку воды небо черпадло йсоу пшкозены, вздуч в топнем загизении, пржилиш много воды ве выробкуз.Zkontrolujte nastavitelný obtok. Zavolejte servisního technika.
        Kontakt na servis

        Nečekejte, dokud se kotel opraví sám. Vyhledejte odborníka ve vašem okolí a neriskujte bezpečnost. Na stránce firmy vaillant.cz v sekci Servisní síť, snadno najdete, který servisní technik ve vašem okolí by vám mohl pomoci odstranit problém a předcházet dalším. V sekci Kontakt najdete důležité emaily a telefonní čísla.

        Это значит, что нужно следить за информацией на дисплее.

        Атака

        Slovenská firma, která vyrábí tepelnou techniku.Má za sebou 19 letou tradici a спокойный заказ. Mají на svém kontě různé druhy kotlů, plynové, na tuhé palivo, palety, akumulační nádrže a jiné.

        • E02 Poruchy tlaku kotle - hodnota tlaku kotle mimo provozní limit nebo poškozený snímač tlaku. Zkontrolujte tlak a zavolejte servisního technika.
        • A01 Porucha hořáku - chyba zapalovací a ionizační elektrody / poškozený plynový vent / ucpaný sifon.